>EE;Circadian rhythm-related;Evening element. Found in the promoters of 31 cycling genes in A.thaliana. Required for circadian control of gene expression;AAAATATCT;A. thaliana | S.melongena;PLACE;Harmer et al., 2000
>CCA1 bs;Circadian rhythm-related;MYB-related CCA1 (Circadian Clock Associated 1) binding site. Required for phytochrome and light regulation of A.thaliana genes encoding chloroplast targeted proteins like LHCII, ELIP1 and chlorophyll biosynthesis components. CCA1 interacts with two imperfect repeats of AAMAATCT;AAMAATCT;A. thaliana;AGRIS;Wang et al., 1998 | McCormac et al., 2002
>CIRCADIAN;Circadian rhythm-related;Necessary for circadian expression of tomato Lhc gene;CAANNNNATC;L. esculentum;PlantCARE | PLACE;Piechulla et al., 1998
>LRE;Light stimulus-related;Positive cis-element found in parsley chs gene promoters for light regulation. Binding site of Arabidopsis bZIP protein HY5. Deletion and mutations of G-box of light promoters compromises their ability to respond to the stimulus. G-box require at least one additional cis-acting element for appropriate transcriptional activation;TGACACGTGGCA;N. tabaccum | P. crispum;PLACE;Castresana et al., 1988 | Menkens et al., 1995
>HY5 bs i;Light stimulus-related;Positive cis-element for light regulation. Binding site of Arabidopsis bZIP protein HY5 which activates photmorphogenesis and root development. Predicted in auxin- and CK-related gene promoters;RRTGACGTVD;A. thaliana;-;Lee et al., 2007 | Song et al., 2008
>HY5 bs ii;Light stimulus-related;Positive cis-element for light regulation. Binding site of Arabidopsis bZIP protein HY5 which activates photmorphogenesis and root development. Predicted in auxin- and CK-related gene promoters;CCACGTGKCAT;A. thaliana | N. tabaccum | P. crispum;footprintDB | PLACE;Castresana et al., 1988 | Chattopadhyay et al., 1998 | Cluis et al., 2004
>Z-box;Light stimulus-related;ZBF1/MYC2/rd22BP1/JIN1/JAI1 bs. Z-box. MYC2 is ABA-, JA- and JA-Et-related TF. MYC2 gene is induced by ABA, ABA+JA (although no synergistic effect was seen and later it was proven that ABA activates JA pathway), wounding (both local and systemic. Mutant myc2 plants are ABA-sensitive and have increased resistance to necrotrophic pathogens. OE-MYC2 plants are ABA- and JA-hypersensitive and osmotic tolerant. MYC2 is negative regulator of blue-light photomorphogenesis and of blue and far-red-light-regulated gene expression. MYC2 was ABA-induced and reported to bind CACATG motif at dehydration-responsive rd22 promoter. JIN1 represses genes involved in defense responses against pathogens (PR4, PR1, and PDF1.2) and activates JA-systemic responses to wounding, insects and herbivores (inducing VSP2, LOX3 and TAT genes). MYC2 is not sufficient to actívate JA or ABA pathways. ERF1 acts in opposite way regards both groups of genes. JA-induction of VSP2 expression was prevented in OE-ERF1 lines so Et repression of wounding-related genes occurs downstream of (or apart from) MYC2;ATACGTGT;A. thaliana;-;Abe et al., 1997 | Lorenzo et al., 2004 | Yadav et al., 2005
>JIN1 bs;Light stimulus-related;ZBF1/MYC2/rd22BP1/JIN1/JAI1 bs. Z-box. MYC2 is ABA-, JA- and JA-Et-related TF. MYC2 gene is induced by ABA, ABA+JA (although no synergistic effect was seen and later it was proven that ABA activates JA pathway), wounding (both local and systemic. Mutant myc2 plants are ABA-sensitive and have increased resistance to necrotrophic pathogens. OE-MYC2 plants are ABA- and JA-hypersensitive and osmotic tolerant. MYC2 is negative regulator of blue-light photomorphogenesis and of blue and far-red-light-regulated gene expression. MYC2 was ABA-induced and reported to bind CACATG motif at dehydration-responsive rd22 promoter. JIN1 represses genes involved in defense responses against pathogens (PR4, PR1, and PDF1.2) and activates JA-systemic responses to wounding, insects and herbivores (inducing VSP2, LOX3 and TAT genes). MYC2 is not sufficient to actívate JA or ABA pathways. ERF1 acts in opposite way regards both groups of genes. JA-induction of VSP2 expression was prevented in OE-ERF1 lines so Et repression of wounding-related genes occurs downstream of (or apart from) MYC2;TGACACGT;A. thaliana;footprintDB;Abe et al., 1997 | Lorenzo et al., 2004 | Yadav et al., 2005
>G-box i;Light stimulus-related;P.sativum rbcS1A G-box. Binding site of GBF (CG-1) factor;CACATGGCACT;P. sativum;PLACE;Gilmartin et al., 1990
>SORLIP;Light stimulus-related;SORLIP5. One of the unknown motifs over-represented in light- and phyA-induced promoters along with others and G-box CACGTG (also over-represented in promoters of repressed genes). More predominant in early than later-induced promoters;GAGTGAG;A. thaliana;PLACE;Hudson and Quail, 2003
>SORLEP;Light stimulus-related;SORLEP3. One of the unknown motifs over-represented along with others and G-box CACGTG (also over-represented in promoters of induced genes) in light- and phyA-reppressed promoters;TGTATATAT;A. thaliana;PLACE;Hudson and Quail, 2003
>T-box;Light stimulus-related;Found in A.thaliana GAPB (B subunit of chloroplast GADPH) gene promoter along with PI and PII. Mutations in resulted in reduction of light-inducibility. Not present in light-inducible GAPA gene;ACTTTG;A. thaliana;PLACE;Chan et al., 2001
>REalpha;Light stimulus-related;Found in Lemna gibba Lhcb21 gene promoter (and highly conserved in other Lhcb genes) for phytochrome regulation. In vitro DNA binding activity from extracts is higher in etiolated plants than in green plants;AACCAA;L. gibba;PLACE;Degenhardt and Tobin, 1996
>REbeta;Light stimulus-related;Found in Lemna gibba Lhcb21 gene promoter (and highly conserved in other Lhcb genes) for phytochrome regulation;CGGATA;L. gibba;PLACE;Degenhardt and Tobin, 1996
>3AF1-box;Light stimulus-related;Box VI. Tetramer of the AT-rich target of 3AF1 DNA binding activity from nuclear extracts. Found in pea rbcS-3A light-responsive promoter;AAATAGATAAATAAAAACATT;P.sativum;PLACE;Lam et al., 1990
>B-box;Light stimulus-related;Found in P.sativum Asp synthetase AS1 gene promoter which is negatively regulated by light;AAACGACACCGTTT;P. sativum;PLACE;Ngai et al., 1997
>L-box;Light stimulus-related;Found in L. esculentum rbcS-3A promoter. Low evolutionary conservation degree;AAATTAACCAA;L. esculentum | N. tabaccum;PLACE;Giuliano et al., 1988
>PI;Light stimulus-related;Found in A.thaliana GAPB (B subunit of chloroplast GADPH) gene promoter along with T-boxes and PII. Mutations in resulted in reduction of light-inducibility. Not present in light-inducible GAPA gene;GTGATCAC;A. thaliana;PLACE;Chan et al., 2001
>PII;Light stimulus-related;Found in A.thaliana GAPB (B subunit of chloroplast GADPH) gene promoter along with T-boxes and PI. Mutations in resulted in reduction of light-inducibility. Not present in light-inducible GAPA gene;TTGGTTTTGATCAAAACCAA;A. thaliana;PLACE;Chan et al., 2001
>Light HSE;Light stimulus-related;Heat shock promoter element. HSF binding site. Found enriched in set of genes induced by modification of cellular redox state of Arabidopsis plants. Found in APX2 promoter neccessary for its excess light or low light plus herbicide treatment-driven expression. HSF1AD, A2 and A3 were found key factors regulating APX2 expression;GAANNTCC;A. thaliana;-;Jung et al., 2013
>I-box;Light stimulus-related;Found in light-responsive N. plumbaginifolia rbcS-8B promoter. Part of HY5-regulable CMA5 (Conserved Module Array 5 in angiosperms) along with a G-box. CMA5 is the minimal unit capable of activating a heterologous minimal promoter in a phytochrome-, cryptochrome-, and plastid-dependent manner. Found in L. esculentum rbcS-3A promoter. Low evolutionary conservation degree;GATAAGR;L. esculentum | A. thaliana | N. plumbaginifolia;PLACE;Giuliano et al., 1988 | Martinez-Hernandez et al., 2002 | López-Ochoa et al., 2007
>MYB4 bs;Light stimulus-related;R2R3-MYB binding site. Found in P. crispum light-responsive CHS, PAL and 4CL gene promoters. PcMYB1 binding site. AtMYB4 is an UV-B-, JA-, SA-, and wounding- responsive nuclear transcriptional repressor. MYB4 mRNA is UV-B-reduced. KO-MYB4 plants had higher levels of UV-protective sinapate esters (which correlates with enhanced expression of 4CL) and were more tolerant to UV-B light;AMCWAMC;A. thaliana | P. crispum;-;Feldbrügge et al., 1997 | Rushton and Somssich, 1998 | Jin et al., 2000
>Box II;Light stimulus-related;P.sativum rbcS-3A and C box II. One of the GT-1 boxes for GT-1 binding. GT-1 may act as a molecular switch modulated by calcium-dependent phosphorylation and dephosphorylation in response to light signals;GTGTGGTTAATATG;P. sativum;PLACE;Fluhr et al., 1986
>Z-DNA-forming sequence;Light stimulus-related;Z-box. Found in the Arabidopsis cab1 promoter. Involved in light-dependent developmental expression of the gene | activation of Z-box containing promoters is regulated by COP1 and HY5, phyB and CRY1 photoreceptors act redundantly to induce them in white light;ATACGTGT;A. thaliana;PLACE;Ha and An, 1988
>Box III;Light stimulus-related;P.s. rbcS box III | one of the GT-1 boxes, for GT-1 binding | GT-1 may act as a molecular switch modulated by calcium-dependent phosphorylation and dephosphorylation in response to light signals;ATCATTTTCACT;P. sativum;PLACE;Fluhr et al., 1986
>RE1;Light stimulus-related;RE1. A. sativa phyA3 and P. sativum AS1 gene promoters' motif for PhyAfr-directed repression;CATGGGCGCGG;A.sativa | P. sativum;PLACE;Bruce et al., 1991
>MRE;Light stimulus-related;AtCHS MRE (MYB bs). Found in the LRU (light-responsive unit) of AtCHS (that resembles PcCHS) and required for UV-B and UV-A/blue light responsiveness;TCTAACCTACCA;A. thaliana;PLACE;Hartmann et al., 1998
>PIF3 bs;Light stimulus-related;PIF3 (PHYTOCHROME INTERACTING FACTOR 3) bHLH binding site (G-box). Present in various light-responsive promoters. PhyBfr bounds to PIF3-G-box complex. PIF3 is independent but requires HY5 for light-activation of anthocyanin biosynthetic genes;GDDRVMCACGTGRVVNSB;A. thaliana;TRANSFAC | footprintDB;Martinez-Garcia et al., 2000 | Shin et al., 2007
>HSE i;Heat stimulus-related;Heat shock promoter element. HSF binding site. Found in AtHSP90-1 and in cytosolic pea and Arabidopsis apx1 and heat-induced 2 HSF-dependently expressed gene promoters. Contributes to A. thaliana apx1 gene induction by HS and only partially by methyl viologen. The redox status influence on HSF activity and DNA-binding (Manalo and Liu, 2001). HSF3-overexpressing plants has higher APX activity even under HS;AGAANNTTCT;A. thaliana;AGRIS  | PLACE;Pelham, 1985 | Courgeon et al., 1988 | Storozhenko et al., 1998 | Nover et al., 2001 | Panchuk et al., 2002
>HSE ii;Heat stimulus-related;Heat shock promoter element. HSF binding site. Found in AtHSP90-1 and in cytosolic pea and Arabidopsis apx1 and heat-induced 2 HSF-dependently expressed gene promoters. Contributes to A. thaliana apx1 gene induction by HS and only partially by methyl viologen. The redox status influence on HSF activity and DNA-binding (Manalo and Liu, 2001). HSF3-overexpressing plants has higher APX activity even under HS;GAANNTTCNNGAA;A. thaliana;AGRIS  | PLACE;Pelham, 1985 | Courgeon et al., 1988 | Storozhenko et al., 1998 | Nover et al., 2001
>HSE iii;Heat stimulus-related;Heat shock promoter element. HSF binding site. Found in AtHSP90-1 and in cytosolic pea and Arabidopsis apx1 and heat-induced 2 HSF-dependently expressed gene promoters. Contributes to A. thaliana apx1 gene induction by HS and only partially by methyl viologen. The redox status influence on HSF activity and DNA-binding (Manalo and Liu, 2001). HSF3-overexpressing plants has higher APX activity even under HS;CTNGAANNTTCNAG;A. thaliana;AGRIS  | PLACE;Pelham, 1985 | Courgeon et al., 1988 | Storozhenko et al., 1998 | Nover et al., 2001
>HSE iv;Heat stimulus-related;HSE variant, gap-type 1. Found by chromatin immunoprecipitation and assay in EMSA with HsfA1 protein. The isolated fragment corresponded to Hsp18.2 gene promoter;TTCNNGAANNNNNNNGAA;A. thaliana;-;Guo et al., 2008
>HSE v;Heat stimulus-related;HSE variant, gap-type 2. Found by chromatin immunoprecipitation and assay in EMSA with HsfA1 protein. The isolated fragment corresponded to Hsp81.1 gene promoter;TTCNNNGAANNNNNNNGAA;A. thaliana;-;Guo et al., 2008
>HSE vi;Heat stimulus-related;HSE variant, gap-type 3. Found by chromatin immunoprecipitation and assay in EMSA with HsfA1 protein. The isolated fragment corresponded to Hsp81.1 gene promoter;TTCNNNNGAANNNNNNNGAA;A. thaliana;-;Guo et al., 2008
>HSE vii;Heat stimulus-related;HSE variant, TTC-rich 1. Found by chromatin immunoprecipitation and assay in EMSA with HsfA1 protein. The isolated frgament corresponded to Hsp21 gene promoter;TTCNNNTTCNNNNNNNNTTC;A. thaliana;-;Guo et al., 2008
>HSE viii;Heat stimulus-related;HSE variant, TTC-rich 3. Found by chromatin immunoprecipitation and assay in EMSA with HsfA1 protein. The isolated frgament corresponded to Hsp101 gene promoter;TTCNNTTCNNNNNNNNNNTTCNNNTC;A. thaliana;-;Guo et al., 2008
>HSAS;Heat stimulus-related;HSE-associated sequence. Found enriched in HS up-regulated C.elegans and related species gene promoters. Proven to be functionally active for hsp-16-2-GFP HS-driven expression;GGGTGTC;C.elegans;-;Guhathakurta et al., 2002
>ERF1 bs;Heat stimulus-related;AP2/ERF family member ERF1 (At3g23240) binding site. ERF1 is induced by JA, ET, JA+ET (ABA abolishes this), local and systemic biotic interaction, salt and drougth (JA and ET are required, ABA inhibits it) but not by heat or ABA. ERF1 is downstream to COI1, EIN3 (binds to PERE in ERF1 promoter) and EIN2. ERF1 may act as a master integrator between biotic and abiotic stress signals: under biotic stress, ERF1 bound to GCC boxes but not DRE elements of JA-responsive promoters, but under heat/drought/salt treatments, ERF1 bound to DRE elements of the stress-specific set of promoters. ERF1 and AtERF2 may have overlapping or redundant functions through GCC-box cis-elements. OE-ERF1 plants have enhanced disease resistance and water-deficit, drought, high salt and heat tolerance, increased levels of ABA (possibly through transcriptional induction of NCED), smaller stomatal aperture and higher Pro levels. ERF1 acts conversely to AtMYC2: induces expression of genes involved in defense responses against pathogens (like PR4, PR1, and PDF1.2) and represses gene expression of those genes needed for JA-mediated systemic responses to wounding, insects and herbivores (inducing VSP2, LOX3 and TAT genes);RCCGAC;A. thaliana;-;Cheng et al., 2013
>DREB2A CRT/DRE;Heat stimulus-related;A. thaliana dehydration-, high salinity-, and HS- but not ABA-inducible DREB2A preferential binding site. Found enriched in 35S:DREB2A-affected gene promoters. DREB2A-regulated genes are involved in dehydration, high salinity, and HS stress tolerance but not freezing stress;RCCGAC;A. thaliana;-;Narusaka et al., 2003 | Sakuma et al., 2006
>DREB2A CRT/DRE ii;Heat stimulus-related;A. thaliana dehydration-, high salinity-, and HS- but not ABA-inducible DREB2A preferential binding site. Found enriched in 35S:DREB2A-affected gene promoters. DREB2A-regulated genes are involved in dehydration, high salinity, and HS stress tolerance but not freezing stress;TACTRCCGACAYGA;A. thaliana;-;Narusaka et al., 2003 | Sakuma et al., 2006
>AZRE;Heat stimulus-related;L-azetidine-2-carboxylic acid (AZC) responsive element and OsHsfA4b bs. AZC induces protein misfolding and transcriptional activation of HsfA1, Hsp70A and sHSP genes. Found in Oshsp17.3 promoter and functional for AZC and HS induction;GTCCTGGAC;O.sativa;-;Guan et al., 2010
>STRE i;Heat stimulus-related;Novel HsfA1a binding site (along with gap-type and TTC-rich type motifs) identified by ChIP. Found in AtHsp90-1, Hsp101, At2g07776 (unknown protein), and At5g08500 (transmembrane CLPTM1 family protein) gene promoters. Binding site for mammalian HSF1 (Trinklein et al., 2004) and yeast transcriptional activator Msn2p/Msn4p which is responsive to various stresses (Martinez-Pastor et al., 1996);TGGGAAGGGGCACGACGAG;A. thaliana;-;Haralampidis et al., 2002 | Guo et al., 2008
>STRE ii;Heat stimulus-related;Novel HsfA1a binding site (along with gap-type and TTC-rich type motifs) identified by ChIP. Found in AtHsp90-1, Hsp101, At2g07776 (unknown protein), and At5g08500 (transmembrane CLPTM1 family protein) gene promoters. Binding site for mammalian HSF1 (Trinklein et al., 2004) and yeast transcriptional activator Msn2p/Msn4p which is responsive to various stresses (Martinez-Pastor et al., 1996);AGAGGGGTTAATCGAGATG;A. thaliana;-;Haralampidis et al., 2002 | Guo et al., 2008
>STRE iii;Heat stimulus-related;Novel HsfA1a binding site (along with gap-type and TTC-rich type motifs) identified by ChIP. Found in AtHsp90-1, Hsp101, At2g07776 (unknown protein), and At5g08500 (transmembrane CLPTM1 family protein) gene promoters. Binding site for mammalian HSF1 (Trinklein et al., 2004) and yeast transcriptional activator Msn2p/Msn4p which is responsive to various stresses (Martinez-Pastor et al., 1996);AGGGG;A. thaliana;-;Haralampidis et al., 2002 | Guo et al., 2008
>Site II;Heat stimulus-related;Larkindale and Vierling (2008) found clusters of heat-induced transcripts related to maintenance of cellular metabolism whose main cis-element was site II motif. Cytc-1 promoter directs preferential expression in root and shoot meristems and in anthers, and also is higher in flowers. Proteins present in cauliflower nuclear extracts as well as a recombinant TCP family protein were able to specifically bind to it;TGGGCY;A. thaliana;-;Welchen and Gonzalez, 2005 | Larkindale and Vierling, 2008
>OsAREB1 bs;Heat stimulus-related;OsAREB1 bs. OsAREB1 is induced by ABA, PEG, drought and heat. OE-OsAREB1 A. thaliana plants have enhanced tolerance to drought and heat, and increased levels of ABA and RD29A and B transcripts. A. thaliana AREB1 and 2 are rd29B ABA-induction TFs (Uno et al., 2000);ACGTGCC;O.sativa;-;Jin et al., 2010
>AT-rich sequence i;Heat stimulus-related;In GmHsp17.3-B, an AT-rich upstream sequence has been shown to possess enhancer-like properties (Baumann et al., 1987). Czarnecka-Verner et al. (1992) demonstrated a binding of HMG nuclear proteins (High Mobility Group) and AT-binding factors (ATBFs) to scattered AT-rich sequences of soybean GmHsp17.5-E promoter. These AT-rich sequences are believed to increase transcription through interaction with nuclear scaffold proteins (Czarnecka-Verner et al., 2004). Found distal in heavy metals-, ABA-, heat- and cold-inducible Leshsp23.8 gene promoter;TTAAAAAGTTAAT;L. esculentum;-;Czarnecka et al., 1992 | Yi et al., 2006
>AT-rich sequence ii;Heat stimulus-related;In GmHsp17.3-B, an AT-rich upstream sequence has been shown to possess enhancer-like properties (Baumann et al., 1987). Czarnecka-Verner et al. (1992) demonstrated a binding of HMG nuclear proteins (High Mobility Group) and AT-binding factors (ATBFs) to scattered AT-rich sequences of soybean GmHsp17.5-E promoter. These AT-rich sequences are believed to increase transcription through interaction with nuclear scaffold proteins (Czarnecka-Verner et al., 2004). Found distal in heavy metals-, ABA-, heat- and cold-inducible Leshsp23.8 gene promoter;TAAATTTAAAAATGTTTT;L. esculentum;-;Czarnecka et al., 1992 | Yi et al., 2006
>AT-rich sequence iii;Heat stimulus-related;In GmHsp17.3-B, an AT-rich upstream sequence has been shown to possess enhancer-like properties (Baumann et al., 1987). Czarnecka-Verner et al. (1992) demonstrated a binding of HMG nuclear proteins (High Mobility Group) and AT-binding factors (ATBFs) to scattered AT-rich sequences of soybean GmHsp17.5-E promoter. These AT-rich sequences are believed to increase transcription through interaction with nuclear scaffold proteins (Czarnecka-Verner et al., 2004). Found distal in heavy metals-, ABA-, heat- and cold-inducible Leshsp23.8 gene promoter;TTAAAACTTTAAA;L. esculentum;-;Czarnecka et al., 1992 | Yi et al., 2006
>AT-rich sequence iv;Heat stimulus-related;In GmHsp17.3-B, an AT-rich upstream sequence has been shown to possess enhancer-like properties (Baumann et al., 1987). Czarnecka-Verner et al. (1992) demonstrated a binding of nuclear proteins (high mobility group proteins (HMGs) and AT binding factors (ATBFs)) to scattered AT-rich sequences of soybean GmHsp17.5-E promoter. These AT-rich sequences are believed to increase transcription through interaction with nuclear scaffold proteins (Czarnecka-Verner et al., 2004). Found proximal in heavy metals-, ABA-, heat- and cold-inducible Leshsp23.8 gene promoter;TATATTATAATTTTATATAA;L. esculentum;-;Czarnecka et al., 1992 | Yi et al., 2006
>AT-rich sequence v;Heat stimulus-related;In GmHsp17.3-B, an AT-rich upstream sequence has been shown to possess enhancer-like properties (Baumann et al., 1987). Czarnecka-Verner et al. (1992) demonstrated a binding of HMG nuclear proteins (High Mobility Group) and AT-binding factors (ATBFs) to scattered AT-rich sequences of soybean GmHsp17.5-E promoter. These AT-rich sequences are believed to increase transcription through interaction with nuclear scaffold proteins (Czarnecka-Verner et al., 2004). Found distal in heavy metals-, ABA-, heat- and cold-inducible Leshsp23.8 gene promoter;AATATTTCAAATATAAT;L. esculentum;-;Czarnecka et al., 1992 | Yi et al., 2006
>AT-rich sequence vi;Heat stimulus-related;In GmHsp17.3-B, an AT-rich upstream sequence has been shown to possess enhancer-like properties (Baumann et al., 1987). Czarnecka-Verner et al. (1992) demonstrated a binding of HMG nuclear proteins (High Mobility Group) and AT-binding factors (ATBFs) to scattered AT-rich sequences of soybean GmHsp17.5-E promoter. These AT-rich sequences are believed to increase transcription through interaction with nuclear scaffold proteins (Czarnecka-Verner et al., 2004). Found distal heavy metals-, ABA-, in heat- and cold-inducible Leshsp23.8 gene promoter;ATAAAAAATAATTGAA;L. esculentum;-;Czarnecka et al., 1992 | Yi et al., 2006
>AT-rich sequence vii;Heat stimulus-related;In GmHsp17.3-B, an AT-rich upstream sequence has been shown to possess enhancer-like properties (Baumann et al., 1987). Czarnecka-Verner et al. (1992) demonstrated a binding of HMG nuclear proteins (High Mobility Group) and AT-binding factors (ATBFs) to scattered AT-rich sequences of soybean GmHsp17.5-E promoter. These AT-rich sequences are believed to increase transcription through interaction with nuclear scaffold proteins (Czarnecka-Verner et al., 2004). Found distal in heat- and cold-inducible Leshsp23.8 gene promoter;AATAAAATCTAAAAA;L. esculentum;-;Czarnecka et al., 1992 | Yi et al., 2006
>AT-rich sequence viii;Heat stimulus-related;In GmHsp17.3-B, an AT-rich upstream sequence has been shown to possess enhancer-like properties (Baumann et al., 1987). Czarnecka-Verner et al. (1992) demonstrated a binding of HMG nuclear proteins (High Mobility Group) and AT-binding factors (ATBFs) to scattered AT-rich sequences of soybean GmHsp17.5-E promoter. These AT-rich sequences are believed to increase transcription through interaction with nuclear scaffold proteins (Czarnecka-Verner et al., 2004). Found distal in heavy metals-, ABA-, heat- and cold-inducible Leshsp23.8 gene promoter;ATTTAAATTTTTAA;L. esculentum;-;Czarnecka et al., 1992 | Yi et al., 2006
>MBF1c bs;Heat stimulus-related;Novel heat-responsive regulon apart from HSFs. It includes DREB2A (which acts upstream to HSFA3), HSFB2B, HSFB2A, TBP7, SEN1, At3g21890 and others. MBF1c transcript and protein are induced by HS. It functions upstream SA, trehalose, Et and PR-1 during stress. It interacts with TPS5 for thermotolerance;CTAGA;A. thaliana;-;Suzuki et al., 2008 and 2011
>CCAAT-box;Heat stimulus-related;Found in HSP gene promoters as AtHSP90-1 and in 5UTR of TasHSP26. Normally, CCAAT-boxes are located immediately upstream from the most distal HSE and it acts cooperatively with HSEs. HSEs alone could not transcribe GUS gene significantly and CCAAT-boxes contribute synergistically. C/EBP binding site. An interaction of C/EBP and HSF, bound to their respective cis elements, has been postulated to be required for maximum stress-induced transcription from human hsp70 promoters (Morimoto, 1998);CCAAT;G. max | A. thaliana | T. aestivum;PLACE;Akira et al., 1990 | Rieping and Schoffl, 1992 | Khurana et al, 2013
>CRT/DRE;Cold stimulus-related;C-repeat/Dehydration (CRT)-, high salt-, or low-temperature-Responsive Element (DRE). Cold-inducible DREB1/CBFs and high salinity-inucible DREB2s binding site. Found enriched in cold-inducible and/or 35S::DREB1A-induced gene promoters of Arabidopsis (as LTI78/COR78/RD29A), peach (as PpDhn1, Wisniewski et al., 2006) and soybean. Some ERFs as ERF1 can bind to both GCC-box and DRE motifs (Cheng et al., 2013);RYCGAC;H. vulgare L. | O. sativa | A. thaliana | N. tabaccum;PLACE;Xue, 2003 | Dubouzet et al., 2003 | Benedict et al., 2006 | Maruyama et al., 2012
>Ppdhn1 DRE;Cold stimulus-related;Found in peach tree PpDhn1 gene promoter;CCCGAC;P.persica;;Wisniewski et al., 2006
>DRE-like;Cold stimulus-related;C-repeat/Dehydration (CRT)-, high salt-, or low-temperature-Responsive Element (DRE). Cold-inducible DREB1/CBFs and high salinity-inucible DREB2s binding site. Found enriched in cold-inducible and/or 35S::DREB1A-induced gene promoters of Arabidopsis (as LTI78/COR78/RD29A) and soybean. Some ERFs as ERF1 can bind to both GCC-box and DRE motifs (Cheng et al., 2013);DRCCGACNW;A. thaliana;PLACE;"Shinozaki and Yamaguchi-
Shinozaki, 2000"
>DREB1B/CBF1 and DREB1C/CBF2 bs;Cold stimulus-related;Cold-inducible DREB1B/CBF1 preferential binding site;AYKRCCGACMT;A. thaliana;footprintDB | AGRIS;Maruyama et al., 2004 | Narusaka et al., 2003 | Sakuma et al., 2006 | Hao et al., 2002
>DREB1A/CBF3 bs i;Cold stimulus-related;Cold-inducible DREB1A/CBF3 preferential binding site;TACTRCCGACATGA;A. thaliana;footprintDB;Maruyama et al., 2004 | Narusaka et al., 2003 | Sakuma et al., 2006 | Hao et al., 2002
>DREB1A/CBF3 bs ii;Cold stimulus-related;Cold-inducible DREB1A/CBF3 preferential binding site. Found enriched in Arabidopsis and soybean cold-inducible gene promoters and in downstream gene promoters of induced genes in 35S:DREB1A transgenic plants;RCCGACNT;A. thaliana;AGRIS;Hao et al., 2002
>DREB1C/CBF2 bs putative i;Cold stimulus-related;Cold-inducible DREB1C/CBF2 binding site consensus. Found enriched in cold and OE-CBF2 down-regulated gene promoters;AGNCGNCT;A. thaliana;AGRIS;Vogel et al., 2005
>DREB1C/CBF2 bs putative ii;Cold stimulus-related;Cold-inducible DREB1C/CBF2 binding site consensus. Found enriched in cold and OE-CBF2 down-regulated gene promoters;CACMACAC;A. thaliana;AGRIS;Vogel et al., 2005
>DREB1C/CBF2 bs putative iii;Cold stimulus-related;Cold-inducible DREB1C/CBF2 binding site consensus. Found enriched in cold and OE-CBF2 down-regulated gene promoters;CAAGTTGR;A. thaliana;AGRIS;Vogel et al., 2005
>DREB1C/CBF2 bs putative iv;Cold stimulus-related;Cold-inducible DREB1C/CBF2 binding site consensus. Found enriched in cold and OE-CBF2 down-regulated gene promoters;CGAWCYAG;A. thaliana;AGRIS;Vogel et al., 2005
>DREB1C/CBF2 bs putative v;Cold stimulus-related;Cold-inducible DREB1C/CBF2 binding site consensus. Found enriched in cold and OE-CBF2 down-regulated gene promoters;CTTTGCCT;A. thaliana;AGRIS;Vogel et al., 2005
>DREB1C/CBF2 bs putative vi;Cold stimulus-related;Cold-inducible DREB1C/CBF2 binding site consensus. Found enriched in cold and OE-CBF2 down-regulated gene promoters;TTCNGAGT;A. thaliana;AGRIS;Vogel et al., 2005
>rab28 ABRE;Cold stimulus-related;Found in ABA- and water stress-inducible rab28 promoter. Nuclear protein extracts from embryo and water-stressed leaves generate specific complexes;CCACGTGG;Z. mays;AGRIS;Pla et al., 1993
>LTRE;Cold stimulus-related;Found in DHN1 gene promoters of Vitis;CCGAAA;V. vinifera;-;Yang et al., 2012
>TYNY2 bs;Cold stimulus-related;Cold-, ABA-, drought-, mechanical wounding-, and high salinity-inducible TINY2 (AP2/ERF DREB subfamily member) binding site. DRE in vitro binding of TINY2;TACTRCCGACAT;A. thaliana;-;Wei et al., 2005
>EE i;Cold stimulus-related;Part of evening element, CCA1 and LHY binding site. Related to circadian clock-regulated genes that control cold-inducible gene expression. Found enriched in Arabidopsis cold-inducible gene promoters and in downstream gene promoters of induced genes in 35S:DREB1A transgenic plants. In cold-inducible gene expression in Arabidopsis, parts of the DRE-dependent transcriptional regulatory pathway overlapps with the ABRE-dependent and EE-dependent pathways. Found in peach tree PpDREB2C, PpCBF2 and 4 gene promoters;ATATCM;A. thaliana;-;Maruyama et al., 2012 | Artlip et al., 2013
>EE ii;Cold stimulus-related;Part of evening element, CCA1 and LHY binding site. Related to circadian clock-regulated genes that control cold-inducible gene expression. Found enriched in Arabidopsis cold-inducible gene promoters and in downstream gene promoters of induced genes in 35S:DREB1A transgenic plants. In cold-inducible gene expression in Arabidopsis, parts of the DRE-dependent transcriptional regulatory pathway overlapps with the ABRE-dependent and EE-dependent pathways. Found in peach tree PpDREB2C, PpCBF2 and 4 gene promoters;GATATT;A. thaliana;-;Maruyama et al., 2012
>GT-1 bs;Cold stimulus-related;Found enriched in clusters of cold-, AtDREB1A-C and OsDREB1B co-expressed genes. GT-1 is Ca-phosphorylation activable in response to light;GRWAAW;A. thaliana | O.sativa;-;Lindlof et al., 2009
>WRKY bs;Cold stimulus-related;Found enriched in clusters of cold-, AtDREB1A and B co-expressed genes. Previously identified in promoters of genes responsive to cytosolic Ca2+ (Kaplan et al., 2006);YTGACY;A. thaliana;-;Lindlof et al., 2009
>ABRE-related;Cold stimulus-related;Found enriched in clusters of cold-, AtDREB1A-C and OsDREB1B co-expressed genes. Previously identified in promoters of genes responsive to cytosolic Ca2+ (Kaplan et al., 2006);MACGYGB;A. thaliana | O.sativa;-;Lindlof et al., 2009
>Gma ABRE;Cold stimulus-related;ABA-responsive element. Found enriched in soybean promoters of cold-inducible genes;ACACGT;G. max;-;Maruyama et al., 2012
>OsABRE i;Cold stimulus-related;ABA-responsive element. Found enriched in rice promoters of cold-inducible genes;ACGTAC;O.sativa;-;Maruyama et al., 2012
>OsABRE ii;Cold stimulus-related;ABA-responsive element. Found enriched in rice promoters of cold-inducible genes;GTACGT;O.sativa;-;Maruyama et al., 2012
>MYBC1 bs;Cold stimulus-related;R3-MYB binding site. MYBC1 acts independently from CBFs and ZAT12. Negatively regulates freezing tolerance and cold-induction of classic genes (35S::MYBC1 do not possess these inductions);NHAGATHCKNN;A. thaliana;-;Zhai et al., 2010 | Weirauch et al., 2014
>At ABRE;Cold stimulus-related;ABA-Responsive Element. A.thaliana AREB/ABFs (bZIP | AREB1/ABF1, AREB2/ABF4, and ABF3), ABI5, EmBP-1, TAF-1, and rice TRAB1) TF binding site. Found in Em, rab16, Osem, dehydration- and high salinity-inducible rd29b (Uno et al., 2000) gene promoters and enriched in Arabidopsis and soybean promoters of cold-inducible genes, in downstream genes of 35S:DREB1A transgenic plants, and in the late-responsive cluster (27 h of treatment) of A. thaliana cold-responsive genes (Chen et al., 2002). Parts of the DRE-dependent transcriptional regulatory pathway overlapped with the ABRE-dependent and EE-dependent pathways. Found in peach tree PpDhn1 gene promoter (Wisniewski et al., 2006);BACGTGKM;A. thaliana;AGRIS |PlantCARE | PLACE;Hannah et al., 2005 | Maruyama et al., 2012
>Gma T/G-box;Cold stimulus-related;Coupling element of ABRE. Found enriched in soybean promoters of cold-inducible genes;CACGTT;G. max;-;Maruyama et al., 2012
>Gma CE3 i;Cold stimulus-related;Coupling element 3. Related to ABRE. Found enriched in soybean promoters of cold-inducible genes. CGCG-box and RWR (Rapid Wound Response) transcripts RSRE motif for SR/CAMTA binding (Walley et al., 2007 | Doherty et al., 2009);ACGCGT;G. max;-;Maruyama et al., 2012
>Gma CE3 ii;Cold stimulus-related;Coupling element 3. Related to ABRE. Found enriched in soybean promoters of cold-inducible genes. CGCG-box and RWR (Rapid Wound Response) transcripts RSRE motif for SR/CAMTA binding (Walley et al., 2007 | Doherty et al., 2009);CGCGTT;G. max;-;Maruyama et al., 2012
>Osa cold Novel i;Cold stimulus-related;Novel cis-element. Found as the most enriched motif in rice promoters of cold-inducible genes;GTAGTA;O.sativa;-;Maruyama et al., 2012
>Osa cold Novel ii;Cold stimulus-related;Novel cis-element. Found as the most enriched motif in rice promoters of cold-inducible genes;CGTACG;O.sativa;-;Maruyama et al., 2012
>Gma cold Novel i;Cold stimulus-related;Novel cis-element. Found enriched motif in soybean promoters of cold-inducible genes;CCGTGT;G. max;-;Maruyama et al., 2012
>Gma cold Novel ii;Cold stimulus-related;Novel cis-element. Found enriched motif in soybean promoters of cold-inducible genes;AACACG;G. max;-;Maruyama et al., 2012
>CG-1 element i;Cold stimulus-related;CGCG-box. CG-1 element. A.thaliana CAMTA1, 3 (AtSR1) and 5 binding site. CM2 in ZAT12 and CBF2 promoters. Positive cold regulatory element. It overlaps ICEr2. CAMTA1 and 3 possess CG-1 DNA binding domain. AtSR1-6 (Signal-Responsive genes) CaMBD domains bind to Ca2+/CaM (calmodulin). Found in 13 of 30 early cold-responsive gene promoters (500 pb upstream of TSS) and in peach tree PpCBF2, 4  and 5 gene promoters. RWR (Rapid Wound Response) transcripts RSRE motif (Walley et al., 2007);TAAAMCGCGSAACA;A. thaliana | P. crispum;footprintDB;da Costa e Silva, 1994 | Yang and Poovaiah, 2002 | Doherty et al., 2009 
>CGCG-box;Cold stimulus-related;CG-1 element-like. CG-1 box allows A.thaliana CAMTA1, 3 (AtSR1) and 5 binding. RWR (Rapid Wound Response) transcripts RSRE motif for SR/CAMTA binding (Walley et al., 2007 | Doherty et al., 2009);TCGCGA;A. thaliana;-;Doherty et al., 2009
>CG-1 element ii;Cold stimulus-related;CGCG-box. CG-1 element. A.thaliana CAMTA1, 3 (AtSR1) and 5 binding site. CM2 in ZAT12 and CBF2 promoters. Positive cold regulatory element. It overlaps ICEr2. CAMTA1 and 3 possess CG-1 DNA binding domain. AtSR1-6 (Signal-Responsive genes) CaMBD domains bind to Ca2+/CaM (calmodulin).Found in 13 of 30 early cold-responsive gene promoters (500 pb upstream of TSS) and in peach tree PpCBF2, 4  and 5 gene promoters. RWR (Rapid Wound Response) transcripts RSRE motif for SR/CAMTA binding (Walley et al., 2007 | Doherty et al., 2009);VCGCGB;A. thaliana;-;da Costa e Silva, 1994 | Yang and Poovaiah, 2002 | Doherty et al., 2009 
>CM1;Cold stimulus-related;Conserved sequence found in A.thaliana CBF2 and ZAT12 promoters. Along with CM2 are minimal for ensuring cold-induction;GACCMCA;A. thaliana;-;Doherty et al., 2009
>CM3;Cold stimulus-related;Conserved sequence found in A.thaliana CBF2 and ZAT12 promoters;AGAGAC;A. thaliana;-;Doherty et al., 2009
>CM6;Cold stimulus-related;Conserved sequence found in A.thaliana CBF2 and ZAT12 promoters. Repressor functionality in CBF2 cold-induction;AGATTCTCA;A. thaliana;-;Doherty et al., 2009
>ICEr1-like;Cold stimulus-related;Conserved sequence found in peach cold-inducible (at CI-delaying 0 °C and at CI-inducing 5 °C) PpCBF1, 5 and 6 gene promoters. Also found aligned in AtCBF2 gene promoter;CACCTGBCWBHT;P.persica | A. thaliana;-;Liang et al., 2013
>ICEr2-like i;Cold stimulus-related;Conserved sequence found in peach cold-inducible (at CI-delaying 0 °C and at CI-inducing 5 °C) PpCBF1 and 6 gene promoters. Also found aligned in AtCBF2 gene promoter;ACTCCAGBR;P.persica | A. thaliana;-;Liang et al., 2013
>ICEr2-like ii;Cold stimulus-related;Conserved sequence found in peach cold-inducible (at CI-delaying 0 °C and at CI-inducing 5 °C) PpCBF5 and cold-non-responsive (they mantained their transcript levels during cold storage) PpCBF2, 3 and 4 gene promoters. Also found aligned in AtCBF2 gene promoter;ACTCCGBG;P.persica | A. thaliana;-;Liang et al., 2013
>CM4;Cold stimulus-related;Conserved sequence found in A.thaliana CBF2 promoter. Repressor activity in CBF2 cold-induction. Core binding site for bZIP transcription factors. G-box binding site or Myc binding site (could be ICE1 bs);TCCACGTG;A. thaliana;-;Doherty et al., 2009
>CM5;Cold stimulus-related;Conserved sequence found in A.thaliana CBF2 and ZAT12 promoters;CTTMGCTG;A. thaliana;-;Doherty et al., 2009
>CM7;Cold stimulus-related;Conserved sequence found in A.thaliana CBF2 and ZAT12 promoters;GGGTMAAAG;A. thaliana;-;Doherty et al., 2009
>ARR5/7/15 bs;Cold stimulus-related;ARR1AT Myb-like site. Type A ARR7 and 15 rapidly respond to CK and cold at the mRNA level (Vogel et al., 2005). Overexpression of these ARR-Myc genes and application of CK enhanced freezing tolerance of plants. ARR7 is repressor of CK responses. It has been suggested that the CK receptors Arabidopsis histidine kinase2/3 and type-A Arabidopsis response regulators (ARRs) act as negative regulators in cold stress signaling through the inhibition of ABA-dependent pathway;NGATT;A. thaliana;-;Jeon et al., 2010
>EIN3/EIL1-3 bs i;Cold stimulus-related;EIN3 (Ethylene-Insensitive3) / EIL1-3 (Ethylene-Insensitive3-like 1-3) binding site. EBS. EIN3 is cold-induced and negatively regulates CBFs and tyoe A ARR5, 7 and 15 expression by binding directly to their promoters. It has been suggested that the CK receptors Arabidopsis histidine kinase2/3 and type-A Arabidopsis response regulators (ARRs) act as negative regulators in cold stress signaling through the inhibition of the ABA-dependent pathway (Jeon et al., 2010). Et-induced EIN3/EIL1 stability is mediated by the proteasomal degradation of two F-box proteins, EIN3 Binding F-box1 (EBF1) and EBF2;AYGHAYVY;A. thaliana;AGRIS;"Shi et al., 2012 | Kosugi and Ohashi, 2000 | Chen et al., 2009 | Zhong et al., 2009 | Boutrot et al., 2010 |
Zhang and Huang, 2011"
>EIN3/EIL1-3 bs ii;Cold stimulus-related;EIN3 (Ethylene-Insensitive3) / EIL1-3 (Ethylene-Insensitive3-like 1-3) binding site. EBS. EIN3 is cold-induced and negatively regulates CBFs and tyoe A ARR5, 7 and 15 expression by binding directly to their promoters. It has been suggested that the CK receptors Arabidopsis histidine kinase2/3 and type-A Arabidopsis response regulators (ARRs) act as negative regulators in cold stress signaling through the inhibition of the ABA-dependent pathway (Jeon et al., 2010). Et-induced EIN3/EIL1 stability is mediated by the proteasomal degradation of two F-box proteins, EIN3 Binding F-box1 (EBF1) and EBF2;AYGWAYCT;A. thaliana;AGRIS;Kosugi and Ohashi, 2000 | Chen et al., 2009 | Zhong et al., 2009 | Boutrot et al., 2010 | Zhang and Huang, 2011 | Shi et al., 2012
>EIN3/EIL1-3 bs iii;Cold stimulus-related;EIN3 (Ethylene-Insensitive3) / EIL1-3 (Ethylene-Insensitive3-like 1-3) binding site. EBS. EIN3 is cold-induced and negatively regulates CBFs and tyoe A ARR5, 7 and 15 expression by binding directly to their promoters. It has been suggested that the CK receptors Arabidopsis histidine kinase2/3 and type-A Arabidopsis response regulators (ARRs) act as negative regulators in cold stress signaling through the inhibition of the ABA-dependent pathway (Jeon et al., 2010). Et-induced EIN3/EIL1 stability is mediated by the proteasomal degradation of two F-box proteins, EIN3 Binding F-box1 (EBF1) and EBF2;TTCAAGGGGGCATGTATCTTGAA;A. thaliana;AGRIS;Kosugi and Ohashi, 2000 | Chen et al., 2009 | Zhong et al., 2009 | Boutrot et al., 2010 | Zhang and Huang, 2011 | Shi et al., 2012
>as1 / ocs element;Cold stimulus-related;OsROS-bZIP bs iii or JARE (JA-Responsive Element) motif. TGA-type bZIP, cold- and H2O2-inducible (but not ABA-) ROS-bZIP, and OBF (Ocs element Binding Factor, bZIP) binding site. Found in both pathogen and plant promoters, especially in: SA-, auxin- or H2O2-inducible GST6, Agrobacterium OCS (octopine synthase), A.thaliana PDF1.2 and MeJA- and wound-inducible LOX1, and H.vulgare LOX (lipoxygenase). GST6 promoter also contains OBP1, 4, 5 (OBF-binding protein) binding site and OBP1 stimulates OBFs binding (Zhang et al., 1995). Part of the second highly conserved group of motifs in cold- or H2O2-responsive promoters of rice japonica chilling tolerant cultivar (potentially CBF-independent regulon);TGACG;A. thaliana | A. tumefaciens | H.vulgare L. | O.sativa;-;Bouchez et al., 1989 | Chen et al., 1996 | Rouster et al., 1997 | Chen and Singh, 1999 | Cheng et al., 2007
>OsROS-bZIP bs i;Cold stimulus-related;TGA-type bZIP, cold- and H2O2-inducible (but not ABA-) ROS-bZIP, and OBF (Ocs element Binding Factor, bZIP) binding site. Found in both pathogen and plant promoters specially in GST6 and OCS octopine synthase. Part of the second highly conserved group of motifs in cold- or H2O2-responsive promoters of rice japonica chilling tolerant cultivar (potentially CBF-independent regulon);GATGA;A. thaliana | O.sativa;-;Cheng et al., 2007
>OsROS-bZIP bs ii;Cold stimulus-related;TGA-type bZIP, cold- and H2O2-inducible (but not ABA-) ROS-bZIP, and OBF (Ocs element Binding Factor, bZIP) binding site. Found in both pathogen and plant promoters specially in GST6 and OCS octopine synthase. Part of the second highly conserved group of motifs in cold- or H2O2-responsive promoters of rice japonica chilling tolerant cultivar (potentially CBF-independent regulon). Signature sequence of W-box in WRKY-target genes;TTGATC;A. thaliana | O.sativa;-;Cheng et al., 2007
>RAV1-A i;Cold stimulus-related;5'-part of bipartite A.thaliana RAV1 binding site. Cold- and mechanical stress-inducible and BR-reppressed RAV1 binding site. RAV2 is also mechanical stress-inducible;MWGCAACAKWWA;A. thaliana;AGRIS  | PLACE  | footprintDB;Kagaya et al., 1999 | Kagaya et al., 2009
>RAV1-A ii;Cold stimulus-related;5'-part of bipartite A.thaliana RAV1 binding site. Cold- and mechanical stress-inducible and BR-reppressed RAV1 binding site. RAV2 is also mechanical stress-inducible;CAACA;A. thaliana;AGRIS  | PLACE;Kagaya et al., 1999 | Kagaya et al., 2009
>RAV1-B i;Cold stimulus-related;5'-part of bipartite A.thaliana RAV1 binding site. Cold- and mechanical stress-inducible and BR-reppressed RAV1 binding site. RAV2 is also mechanical stress-inducible;WTCACCTGRSSY;A. thaliana;AGRIS  | PLACE  | footprintDB;Kagaya et al., 1999 | Kagaya et al., 2009
>RAV1-B ii;Cold stimulus-related;5'-part of bipartite A.thaliana RAV1 binding site. Cold- and mechanical stress-inducible and BR-reppressed RAV1 binding site. RAV2 is also mechanical stress-inducible;CACCTG;A. thaliana;AGRIS  | PLACE;Kagaya et al., 1999 | Kagaya et al., 2009
>RAP2.6 CE1 bs;Cold stimulus-related; ABA-, high salinity-, osmotic- and cold-inducible RAP2.6 binding site along with GCC element. OE-RAP2.6 plants are hypersensitive to exogenous ABA and abiotic stresses during seed germination and early seedling growth. Also, OE-RAP2.6 plants have decreased  ABA after salt treatment and AtABI4 and some stress inducible are increased. Loss of ABI4 function rescues the hypersensitive phenotype. These results suggest that RAP2.6 participates in abiotic stress, possibly through ABA-dependent pathway;TGCCACCGG;A. thaliana;-;Zhu et al., 2010
>RAP2.6 GCC-box bs;Cold stimulus-related; ABA-, high salinity-, osmotic- and cold-inducible RAP2.6 binding site along with CE1 element. OE-RAP2.6 plants are hypersensitive to exogenous ABA and abiotic stresses during seed germination and early seedling growth. Also, OE-RAP2.6 plants have decreased  ABA after salt treatment and AtABI4 and some stress inducible are increased. Loss of ABI4 function rescues the hypersensitive phenotype. These results suggest that RAP2.6 participates in abiotic stress, possibly through ABA-dependent pathway. ERF/EREBPs (AtERF1, 2, 5, 7, ERF6 (ROSE7) N.tabaccum ERF2-4, L.esculentum Pti4-6 activators and 3 and 4 reppressors) and certain AP2s (AtEBP/RAP2.3, RAP2.6) binding site;AGCCGCC;A. thaliana;-;Zhu et al., 2010
>ZAT10 bs i;Cold stimulus-related;Cold- and LOS2-inducible ZAT10/STZ binding site within the EP2 sequence consisting of AGT tandem repeats whose spacing is important (for ZPT2-2) to distinguish target sequences. ZAT10 is similar to AZFs and petunia ZPT2-2 (EPF2-5) and it represses the trans-activation of genes through an essential repression motif (Ohta et al., 2001). Found in RD29A gene promoter for repression of expression. OE-DREB1A plants have enhanced levels of STZ (Maruyama et al., 2004) and DRE at ZAT10 promoter may function as a cis-acting element for its expression under drought, high-salt, and cold stress conditions. ZAT10 could have a subregulon of CBFs and might regulate a subset of genes involved in cold acclimation. ZAT10 and/or 12 play a key role in abiotic stress tolerance which could be attributed to the specific activation of antioxidant defence genes as cAPX1 and FSD1. OE-ZAT10 is drought tolerant;ACTAGTGTANNNNNNNNNNNNNTCTAGTAAG;A. thaliana;-;Lee et al., 2002 | Sakamoto et al., 2004
>ZAT10 bs ii;Cold stimulus-related;Cold- and LOS2-inducible ZAT10/STZ binding site within the EP2 sequence consisting of AGT tandem repeats whose spacing is important (for ZPT2-2) to distinguish target sequences. ZAT10 is similar to AZFs and petunia ZPT2-2 (EPF2-5) and it represses the trans-activation of genes through an essential repression motif (Ohta et al., 2001). Found in RD29A gene promoter for repression of expression. OE-DREB1A plants have enhanced levels of STZ (Maruyama et al., 2004) and DRE at ZAT10 promoter may function as a cis-acting element for its expression under drought, high-salt, and cold stress conditions. ZAT10 could have a subregulon of CBFs and might regulate a subset of genes involved in cold acclimation. ZAT10 and/or 12 play a key role in abiotic stress tolerance which could be attributed to the specific activation of antioxidant defence genes as cAPX1 and FSD1. OE-ZAT10 is drought tolerant;AGTNNNNNNNNNNNNNNNNNNNAGT;A. thaliana;-;Lee et al., 2002
>ZAT10 bs iii;Cold stimulus-related;Cold- and LOS2-inducible ZAT10/STZ binding site within the EP2 sequence consisting of AGT tandem repeats whose spacing is important (for ZPT2-2) to distinguish target sequences. ZAT10 is similar to AZFs and petunia ZPT2-2 (EPF2-5) and it represses the trans-activation of genes through an essential repression motif (Ohta et al., 2001). Found in RD29A gene promoter for repression of expression. OE-DREB1A plants have enhanced levels of STZ (Maruyama et al., 2004) and DRE at ZAT10 promoter may function as a cis-acting element for its expression under drought, high-salt, and cold stress conditions. ZAT10 could have a subregulon of CBFs and might regulate a subset of genes involved in cold acclimation. ZAT10 and/or 12 play a key role in abiotic stress tolerance which could be attributed to the specific activation of antioxidant defence genes as cAPX1 and FSD1. OE-ZAT10 is drought tolerant;ASTNNNAST;A. thaliana;-;Sakamoto et al., 2004
>ZAT10 bs iv;Cold stimulus-related;Cold- and LOS2-inducible ZAT10/STZ binding site within the EP2 sequence consisting of AGT tandem repeats whose spacing is important (for ZPT2-2) to distinguish target sequences. ZAT10 is similar to AZFs and petunia ZPT2-2 (EPF2-5) and it represses the trans-activation of genes through an essential repression motif (Ohta et al., 2001). Found in RD29A gene promoter for repression of expression. OE-DREB1A plants have enhanced levels of STZ (Maruyama et al., 2004) and DRE at ZAT10 promoter may function as a cis-acting element for its expression under drought, high-salt, and cold stress conditions. ZAT10 could have a subregulon of CBFs and might regulate a subset of genes involved in cold acclimation. ZAT10 and/or 12 play a key role in abiotic stress tolerance which could be attributed to the specific activation of antioxidant defence genes as cAPX1 and FSD1. OE-ZAT10 is drought tolerant;ASTNNNNAST;A. thaliana;-;Sakamoto et al., 2004
>ZAT10 bs v;Cold stimulus-related;Cold- and LOS2-inducible ZAT10/STZ binding site within the EP2 sequence consisting of AGT tandem repeats whose spacing is important (for ZPT2-2) to distinguish target sequences. ZAT10 is similar to AZFs and petunia ZPT2-2 (EPF2-5) and it represses the trans-activation of genes through an essential repression motif (Ohta et al., 2001). Found in RD29A gene promoter for repression of expression. OE-DREB1A plants have enhanced levels of STZ (Maruyama et al., 2004) and DRE at ZAT10 promoter may function as a cis-acting element for its expression under drought, high-salt, and cold stress conditions. ZAT10 could have a subregulon of CBFs and might regulate a subset of genes involved in cold acclimation. ZAT10 and/or 12 play a key role in abiotic stress tolerance which could be attributed to the specific activation of antioxidant defence genes as cAPX1 and FSD1. OE-ZAT10 is drought tolerant;TTGACAGTGTCACTTGACAGTGTAC;A. thaliana;-;Sakamoto et al., 2004
>LOS2 bs;Cold stimulus-related;Cold- and LOS2-inducible ZAT10/STZ binding site within the EP2 sequence consisting of AGT tandem repeats whose spacing is important (for ZPT2-2) to distinguish target sequences. ZAT10 is similar to AZFs and petunia ZPT2-2 (EPF2-5) and it represses the trans-activation of genes through an essential repression motif (Ohta et al., 2001). Found in RD29A gene promoter for repression of expression. OE-DREB1A plants have enhanced levels of STZ (Maruyama et al., 2004) and DRE at ZAT10 promoter may function as a cis-acting element for its expression under drought, high-salt, and cold stress conditions. ZAT10 could have a subregulon of CBFs and might regulate a subset of genes involved in cold acclimation. ZAT10 and/or 12 play a key role in abiotic stress tolerance which could be attributed to the specific activation of antioxidant defence genes as cAPX1 and FSD1. OE-ZAT10 is drought tolerant;TNNCGCNNNNTATAAAAGCCGNNTTTT;A. thaliana;-;Lee et al., 2002
>ZAT12 bs putative i;Cold stimulus-related;ZAT12 predicted binding site. Found enriched in cold and OE-ZAT12 up-regulated  genes. ZAT10/12 plays a key role in abiotic stress tolerance, which could be attributed to the specific activation of antioxidant defense genes as cAPX1 and FSD1.ZAT12 is ICE1 activated through binding to its ICEr3 (or ICEr4) cis-elements and its induced cis-regulon falls into ice1 mutation cold-induced (ICE1 cold-repressed) regulon (Benedict et al., 2006);TCSNCTCS;A. thaliana;-;Vogel et al., 2005
>ZAT12 bs putative ii;Cold stimulus-related;ZAT12 predicted binding site. Found enriched in cold and OE-ZAT12 up-regulated  genes. ZAT10/12 plays a key role in abiotic stress tolerance, which could be attributed to the specific activation of antioxidant defense genes as cAPX1 and FSD1.ZAT12 is ICE1 activated through binding to its ICEr3 (or ICEr4) cis-elements and its induced cis-regulon falls into ice1 mutation cold-induced (ICE1 cold-repressed) regulon (Benedict et al., 2006);GCATTGAC;A. thaliana;-;Vogel et al., 2005
>ZAT12 bs putative iii;Cold stimulus-related;ZAT12 predicted binding site. Found enriched in cold and OE-ZAT12 up-regulated  genes. ZAT10/12 plays a key role in abiotic stress tolerance, which could be attributed to the specific activation of antioxidant defense genes as cAPX1 and FSD1.ZAT12 is ICE1 activated through binding to its ICEr3 (or ICEr4) cis-elements and its induced cis-regulon falls into ice1 mutation cold-induced (ICE1 cold-repressed) regulon (Benedict et al., 2006);YCTCTTCA;A. thaliana;-;Vogel et al., 2005
>ZAT12 bs putative iv;Cold stimulus-related;ZAT12 predicted binding site. Found enriched in cold and OE-ZAT12 up-regulated  genes. ZAT10/12 plays a key role in abiotic stress tolerance, which could be attributed to the specific activation of antioxidant defense genes as cAPX1 and FSD1.ZAT12 is ICE1 activated through binding to its ICEr3 (or ICEr4) cis-elements and its induced cis-regulon falls into ice1 mutation cold-induced (ICE1 cold-repressed) regulon (Benedict et al., 2006);CAATGMKG;A. thaliana;-;Vogel et al., 2005
>ZAT12 bs putative v;Cold stimulus-related;ZAT12 predicted binding site. Found enriched in cold and OE-ZAT12 up-regulated  genes. ZAT10/12 plays a key role in abiotic stress tolerance, which could be attributed to the specific activation of antioxidant defense genes as cAPX1 and FSD1.ZAT12 is ICE1 activated through binding to its ICEr3 (or ICEr4) cis-elements and its induced cis-regulon falls into ice1 mutation cold-induced (ICE1 cold-repressed) regulon (Benedict et al., 2006);TGAGGTCA;A. thaliana;-;Vogel et al., 2005
>ZAT12 bs putative vi;Cold stimulus-related;ZAT12 predicted binding site. Found enriched in cold and OE-ZAT12 up-regulated  genes. ZAT10/12 plays a key role in abiotic stress tolerance, which could be attributed to the specific activation of antioxidant defense genes as cAPX1 and FSD1.ZAT12 is ICE1 activated through binding to its ICEr3 (or ICEr4) cis-elements and its induced cis-regulon falls into ice1 mutation cold-induced (ICE1 cold-repressed) regulon (Benedict et al., 2006);RSAATGAG;A. thaliana;-;Vogel et al., 2005
>ZAT12 bs putative vii;Cold stimulus-related;ZAT12 predicted binding site. Found enriched in cold and OE-ZAT12 down-regulated  genes. ZAT10/12 plays a key role in abiotic stress tolerance, which could be attributed to the specific activation of antioxidant defense genes as cAPX1 and FSD1.ZAT12 is ICE1 activated through binding to its ICEr3 (or ICEr4) cis-elements and its induced cis-regulon falls into ice1 mutation cold-induced (ICE1 cold-repressed) regulon (Benedict et al., 2006);MCAACTTS;A. thaliana;-;Vogel et al., 2005
>ZAT12 bs putative viii;Cold stimulus-related;ZAT12 predicted binding site. Found enriched in cold and OE-ZAT12 down-regulated  genes. ZAT10/12 plays a key role in abiotic stress tolerance, which could be attributed to the specific activation of antioxidant defense genes as cAPX1 and FSD1.ZAT12 is ICE1 activated through binding to its ICEr3 (or ICEr4) cis-elements and its induced cis-regulon falls into ice1 mutation cold-induced (ICE1 cold-repressed) regulon (Benedict et al., 2006);AWGAKGWC;A. thaliana;-;Vogel et al., 2005
>ZAT12 bs putative ix;Cold stimulus-related;ZAT12 predicted binding site. Found enriched in cold and OE-ZAT12 down-regulated  genes. ZAT10/12 plays a key role in abiotic stress tolerance, which could be attributed to the specific activation of antioxidant defense genes as cAPX1 and FSD1.ZAT12 is ICE1 activated through binding to its ICEr3 (or ICEr4) cis-elements and its induced cis-regulon falls into ice1 mutation cold-induced (ICE1 cold-repressed) regulon (Benedict et al., 2006);ACAWMTTC;A. thaliana;-;Vogel et al., 2005
>ZAT12 bs putative x;Cold stimulus-related;ZAT12 predicted binding site. Found enriched in cold and OE-ZAT12 down-regulated  genes. ZAT10/12 plays a key role in abiotic stress tolerance, which could be attributed to the specific activation of antioxidant defense genes as cAPX1 and FSD1.ZAT12 is ICE1 activated through binding to its ICEr3 (or ICEr4) cis-elements and its induced cis-regulon falls into ice1 mutation cold-induced (ICE1 cold-repressed) regulon (Benedict et al., 2006);TATCCAAA;A. thaliana;-;Vogel et al., 2005
>ZAT12 bs putative xi;Cold stimulus-related;ZAT12 predicted binding site. Found enriched in cold and OE-ZAT12 down-regulated  genes. ZAT10/12 plays a key role in abiotic stress tolerance, which could be attributed to the specific activation of antioxidant defense genes as cAPX1 and FSD1.ZAT12 is ICE1 activated through binding to its ICEr3 (or ICEr4) cis-elements and its induced cis-regulon falls into ice1 mutation cold-induced (ICE1 cold-repressed) regulon (Benedict et al., 2006);GAMTAAGA;A. thaliana;-;Vogel et al., 2005
>ZAT12 bs putative xii;Cold stimulus-related;ZAT12 predicted binding site. Found enriched in cold and OE-ZAT12 down-regulated  genes. ZAT10/12 plays a key role in abiotic stress tolerance, which could be attributed to the specific activation of antioxidant defense genes as cAPX1 and FSD1.ZAT12 is ICE1 activated through binding to its ICEr3 (or ICEr4) cis-elements and its induced cis-regulon falls into ice1 mutation cold-induced (ICE1 cold-repressed) regulon (Benedict et al., 2006);TAYGCCAG;A. thaliana;-;Vogel et al., 2005
>AtHAP5 bs;Cold stimulus-related;AtHAP5 binding site. Found in AtXTH21 promoter. AtHAP5 (Heme-associated protein) is also known as NF-YA/B/C (NUCLEAR FACTOR Y, SUBUNIT A/B/C) and has a role in freezing tolerance. OE-AtHAP5A and -AtXTH21 plants induced ABA-related genes and inhibited cold-induced ROS accumulation;CCAAT;A. thaliana;-;Shi et al., 2014
>Pp novel i;Cold stimulus-related;Conserved in Ppbec1, Pptha1 and Ppxero2/Ppdhn1 gene promoters. Ppbec1 and Ppxero2 were proven as cold-inducible in transient peach mesocarp and in arabidopsis transgenic plants. The three genes were found in a set of long-term cold-induced ESTs;TACGTSGS;P.persica;-;Tittarelli et al., 2009
>Pp novel ii;Cold stimulus-related;Conserved in Ppbec1, Pptha1 and Ppxero2/Ppdhn1 gene promoters. Ppbec1 and Ppxero2 were proven as cold-inducible in transient peach mesocarp and in arabidopsis transgenic plants. The three genes were found in a set of long-term cold-induced ESTs;TGTGTGYS;P.persica;-;Tittarelli et al., 2009
>Pp novel iii;Cold stimulus-related;Conserved in Ppbec1, Pptha1 and Ppxero2/Ppdhn1 gene promoters. Ppbec1 and Ppxero2 were proven as cold-inducible in transient peach mesocarp and in arabidopsis transgenic plants. The three genes were found in a set of long-term cold-induced ESTs;CTAGAASY;P.persica;-;Tittarelli et al., 2009
>HOS9 bs;Cold stimulus-related;HOS9 (High expression of Osmotically responsive genes 9) homeodomain TF binding site. Enriched in 138 gene promoters of differentially induced transcripts in hos9 mutants. HOS9 is constitutively expressed and not further induced by cold stress but a HOS9 mutant has hyperactivation of osmotically responsive genes by freezing and low temperature (not by ABA or salinity stress) both before and after acclimation. None of the genes affected by the hos9-1 mutation are controlled by CBF family, HOS9 mainly controls basal or constitutive freezing tolerance in Arabidopsis. HOS9 is ICE1 activated through binding to its ICEr3 (or ICEr4) cis-elements;VCKCGT;A. thaliana;-;Zhu et al., 2004 | Benedict et al., 2006
>TaNAC69 bs i;Cold stimulus-related;Cold and drought-inducible TaNAC69 (A.thaliana orthologue is NAP -No apical meristem (NAM) protein-) recongises two cis-elements;RRWRGCGTRTRKTWYACGTAAYY;T.aestivum;footprintDB;Xue et al., 2006
>TaNAC69 bs ii;Cold stimulus-related;Cold and drought-inducible TaNAC69 (A.thaliana orthologue is NAP -No apical meristem (NAM) protein-) recongises two cis-elements;RGTSKTTAWCYTTTRYACGTMWCT;T.aestivum;footprintDB;Xue et al., 2006
>NAC072 bs;Cold stimulus-related;ICEr1 reverse complementary site. Cold-inducible NAC072 binding site found in erd1 promoter. NAC072 has an ICEr3 consensus in its promoter. OE-NAC plants show drought tolerance and ABA- and stress-inducible gene expression but no expression of erd1 was detected (so then the needed coupling TF was discovered: ZFHD1). Double OE-NAC and -ZFHD1 plants showed significantly increased drought tolerance. ICEr1-containing genes are repressed at 24 h in the cold so NAC072 could be related to the longer term repression of the CBF TFs and their downstream regulons via the ICEr1 sites present in the CBF2 and CBF3 promoters;CATGTG;A. thaliana;-;Tran et al., 2004, 2007 | Benedict et al., 2006
>ICE1 bs i;Cold stimulus-related;ICEr1. ICE1 encodes a MYC-like bHLH transcriptional activator that binds to  A.thaliana CBFs gene promoters for ABA-independent cold-inducible expression. As Arabidopsis genome contains more than 160 bHLH TFs, it is possible that MYC-like proteins other than ICE1 may contribute to expression of CBF1 and 2. ICEr1 cis-regulon was not cold-inducible and not enriched in the ICE1-affected gene lists (Benedict et al, 2006);CACATG;B. napus;PLACE;Chinnusamy et al., 2003 | Zarka et al., 2003
>ICE1 bs ii;Cold stimulus-related;ICEr3 motif. ICE1 encodes a MYC-like bHLH transcriptional activator that binds to  A.thaliana CBFs gene promoters for ABA-independent cold-inducible expression. ICEr3 cis-element was enriched in the promoters of genes affected by ice1 mutation and associated with a cis-regulon whose induction preceded the induction of the DRE cis-regulon in wildtype plants so ICE1 binds ICEr3 (and/or ICEr4) to induce expression of the DRE-binding transcriptional activators CBF1-3 (along with ZAT12 and NAC072 transcriptional repressors). PCA showed clear separation of the ICEr3 from the ABRE and ICEr4 motifs. ICEr3 cis-regulon tended to be repressed after cold treatment. Like ABRE, ICEr3 cis-regulon it also responded to salt and mannitol. TFs binding to DRE, HOS9r1, ABRE, ICEr1, ICEr3, ICEr4 are part of ICE1 signaling cascade (becacuse their cis-regulons cold-induction are affected in ice1 background) but ABRE, ICEr3 and ICE4 are also independent from this TF. The regulon of genes differentially regulated in FR light preconditioned phyA mutant plants shows significant overlap with the ICE1-repressed regulon and is enriched for the ICEr3, DRE, and ICEr4 elements so PhyA is an ICE1 transduction pathway mediator. ICE1 promoter does not contain PhyAr1 motif in its promoter. ABA can act to amplify the ICE-/CBF-mediated signal via ICE1 transcript and ICEr3 cis-regulon induction. Not found in rice cold reponsive genes (Lindlöf et al., 2009);HCCACGT;A. thaliana;-;Benedict et al., 2006
>ICE1 bs iii;Cold stimulus-related;ICEr3 motif. ICE1 encodes a MYC-like bHLH transcriptional activator that binds to  A.thaliana CBFs gene promoters for ABA-independent cold-inducible expression. ICEr3 cis-element was enriched in the promoters of genes affected by the ice1 mutation and associated with a cis-regulon whose induction preceded the induction of the DRE cis-regulon in wildtype plants so ICE1 binds ICEr3 (and/or ICEr4) to induce expression of the DRE-binding transcriptional activators CBF1-3 (along with ZAT12 and NAC072 transcriptional repressors). PCA showed clear separation of the ICEr4 from the ABRE and ICEr3 motifs | TFs binding to DRE, HOS9r1, ABRE, ICEr1, ICEr3, ICEr4 are part of ICE1 signaling cascade (becacuse its cis-regulons cold induction is affected in ice1 background) but ABRE, ICEr3 and ICE4 are also independent from this TF. ABA can act to amplify the ICE-/CBF-mediated signal via ICE1 transcript and ICEr3 cis-regulon induction;HACACGT;A. thaliana;-;Benedict et al., 2006
>MYB15 bs i;Cold stimulus-related;R2R3-MYB cold-inducible MYB15 binding site. Type IIG Myb recognition sequence. MYB15 protein interacts with ICE1 and binds to Myb recognition sequences in the CBFs promoters. myb15 mutant plants show increased whereas its overexpression reduces freezing tolerance and CBFs transcript levels (although COR15A and RD29A are largely unaffected);CRACGGTAGGTGG;A. thaliana;-;Romero et al., 1998
>MYB15 bs ii;Cold stimulus-related;R2R3-MYB cold-inducible MYB15 binding site. Type IIG Myb recognition sequence. MYB15 protein interacts with ICE1 and binds to Myb recognition sequences in the CBFs promoters. myb15 mutant plants show increased whereas its overexpression reduces freezing tolerance and CBFs transcript levels (although COR15A and RD29A are largely unaffected);GKTWGKTR;A. thaliana;-;Agarwal et al., 2006
>TA5 box;Cold stimulus-related;OsMYBS3 (with a single DNA-binding domain) potential binding site. OsMYBS3 was previously shown to mediate sugar signaling: it was shown to bind specifically to the 4-times present TA1 box (TATCCA) in the sugar response complex (SRC) of the aAmy3 promoter while MYBS1 and 2 activates it (Lu et al., 2002). OsMYBS3 responded slowly to cold stress in roots and to salt and cold in shoots but it was reduced by ABA in shoots, and A. thaliana orthologue is induced by ABA and NaCl. CM2 and 4, TA2 and 3 motifs are present in the OsMYBS3 promoter. Gain- and loss-of-function analyses indicated that OsMYBS3 was sufficient and necessary for enhancing cold tolerance in rice. OsMYBS3 repressed the well-known DREB1/CBF dependent cold signaling pathway. Found in DREB1B repressed  gene promoters;TATCCT;O.sativa;-;Su et al., 2010
>TA4 box;Cold stimulus-related;OsMYBS3 (with a single DNA-binding domain) potential binding site. OsMYBS3 was previously shown to mediate sugar signaling: it was shown to bind specifically to the 4-times present TA1 box (TATCCA) in the sugar response complex (SRC) of the aAmy3 promoter while MYBS1 and 2 activates it (Lu et al., 2002). OsMYBS3 responded slowly to cold stress in roots and to salt and cold in shoots but it was reduced by ABA in shoots, and A. thaliana orthologue is induced by ABA and NaCl. CM2 and 4, TA2 and 3 motifs are present in the OsMYBS3 promoter. Gain- and loss-of-function analyses indicated that OsMYBS3 was sufficient and necessary for enhancing cold tolerance in rice. OsMYBS3 repressed the well-known DREB1/CBF dependent cold signaling pathway. Found in DREB1B repressed  gene promoters;TATCAC;O.sativa;-;Su et al., 2010
>TA1 box;Cold stimulus-related;OsMYBS3 (with a single DNA-binding domain) potential binding site. OsMYBS3 was previously shown to mediate sugar signaling: it was shown to bind specifically to the 4-times present TA1 box (TATCCA) in the sugar response complex (SRC) of the aAmy3 promoter while MYBS1 and 2 activates it (Lu et al., 2002). OsMYBS3 responded slowly to cold stress in roots and to salt and cold in shoots but it was reduced by ABA in shoots, and A. thaliana orthologue is induced by ABA and NaCl. CM2 and 4, TA2 and 3 motifs are present in the OsMYBS3 promoter. Gain- and loss-of-function analyses indicated that OsMYBS3 was sufficient and necessary for enhancing cold tolerance in rice. OsMYBS3 repressed the well-known DREB1/CBF dependent cold signaling pathway. Found in aAmy3 and DREB1C repressed, and in TPP1 and MDRP4 activated gene promoters;TATCCA;O.sativa;-;Su et al., 2010
>TA3 box;Cold stimulus-related;OsMYBS3 (with a single DNA-binding domain) potential binding site. OsMYBS3 was previously shown to mediate sugar signaling: it was shown to bind specifically to the 4-times present TA1 box (TATCCA) in the sugar response complex (SRC) of the aAmy3 promoter while MYBS1 and 2 activates it (Lu et al., 2002). OsMYBS3 responded slowly to cold stress in roots and to salt and cold in shoots but it was reduced by ABA in shoots, and A. thaliana orthologue is induced by ABA and NaCl. CM2 and 4, TA2 and 3 motifs are present in the OsMYBS3 promoter. Gain- and loss-of-function analyses indicated that OsMYBS3 was sufficient and necessary for enhancing cold tolerance in rice. OsMYBS3 repressed the well-known DREB1/CBF dependent cold signaling pathway. Found in MYBS3, in DREB1A and C repressed, and in WRKY77 activated gene promoters;TATCCG;O.sativa;-;Su et al., 2010
>TA2 box;Cold stimulus-related;OsMYBS3 (with a single DNA-binding domain) potential binding site. OsMYBS3 was previously shown to mediate sugar signaling: it was shown to bind specifically to the 4-times present TA1 box (TATCCA) in the sugar response complex (SRC) of the aAmy3 promoter while MYBS1 and 2 activates it (Lu et al., 2002). OsMYBS3 responded slowly to cold stress in roots and to salt and cold in shoots but it was reduced by ABA in shoots, and A. thaliana orthologue is induced by ABA and NaCl. CM2 and 4, TA2 and 3 motifs are present in the OsMYBS3 promoter. Gain- and loss-of-function analyses indicated that OsMYBS3 was sufficient and necessary for enhancing cold tolerance in rice. OsMYBS3 repressed the well-known DREB1/CBF dependent cold signaling pathway. Found in MYBS3 and in DREB1B repressed gene promoter;TATCCC;O.sativa;-;Su et al., 2010
>MYB bs;Cold stimulus-related;MYB binding site found in ABA-inducible (AREB1 and 2) rd29B gene promoter;TAACTG;A. thaliana;PlantCARE;Uno et al., 2000
>AuxRE i;Auxin signalling-related;Auxin-Responsive Element. ARF binding site. Found in promoters of early auxin response genes as soybean GH3 promoter;TGTCTC;A. thaliana | G.max;PLACE  | TRANSFAC;Liu et al., 1994 | Ulmasov et al., 1999
>AuxRE ii;Auxin signalling-related;Auxin-responsive element. ARF binding site. Found in peach tree PpDhn1 gene promoter. GA and IAA may play an important role in the photoperiodic control of cold acclimation in peach tree;GGTCCRT;P.persica;-;Wisniewski et al., 2006
>AuxRE iv;Auxin signalling-related;Auxin-Responsive Element. ARF binding site. Found in promoters of early auxin response genes;CTTGTCTCCCA;A. thaliana;footprintDB;Ulmasov et al., 1999
>OBF bs;Auxin signalling-related;Ocs element. OBF (Ocs element Binding Factor, bZIP) binding site. Found in both pathogen and plant promoters, especially in: SA-, auxin- or H2O2-inducible GST6, Agrobacterium OCS (octopine synthase). Mutation of the ocs element does not abolish expression. GST6 promoter also contains OBP1, 4, 5 (OBF-binding protein) binding site and OBP1 stimulates OBFs binding (Zhang et al., 1995);ATCTTATGTCATTGATGACGACCTCC;A. thaliana | A. tumefaciens | N. tabaccum;AGRIS;Bouchez et al., 1989 | Chen et al., 1996 | Chen and Singh, 1999
>PHRA bs;Auxin signalling-related;Auxin-inducible PHRA (homeobox) binding site. PHRA requires additional sites for high affinity binding to PHRA bs;TAATTGACTCAATTA;A. thaliana;AGRIS;Plesch et al., 1997
>SGBFs bs;Auxin signalling-related;SGBF-1 and -2 (G-box Binding Factors, bZIP) binding site. Found in soybean auxin-inducible GmAux28 gene promoter. SGBF-1 and -2 belong to different phylogenetic lineages;TCCACGTGTC;G.max;PLACE;Hong et al., 1995
>NtBBF1 bs;Auxin signalling-related;N. tabaccum NtBBF1 (Dof) binding site. Found in Agrobacterium rhizogenes rolB oncogene and required for its tissue-specific and auxin-inducible expression in planta. Tissue-specificity of NtBBF1 expression is remarkably similar to that of rolB;ACTTTA;A.rhizogenes | N. tabaccum;PLACE;Baumann et al., 1999
>TGA-box 1;Auxin signalling-related;Hex-like motif. Found in soybean GH3 and peach tree PpDhn2 gene promoters. Strong binding site for proteins in plant nuclear extracts. GA and IAA may play an important role in the photoperiodic control of cold acclimation in peach tree. GH3 promoter has several auxin-induction motifs;TGACGTAA;G. max | P. persica;PLACE;Liu et al., 1994 | Wisnieski et al., 2006
>Y region;Ethylene signalling-related;Found in tobacco PRB1-b gene promoter and required for its Et-driven induction. There is also an upstream G region;TGTGACATTGAAATTCTTTGACTTTA;N. tabaccum;PLACE;Meller et al., 1993
>ERF3/4 bs;Ethylene signalling-related;GCC-box is A. thaliana AtERF1 to 5 binding site. AtERF1, 2 and 5 are activators but 3 and 4 are reppressors. AtERF genes are stimulated by different conditions as wounding, cold, high salinity, drought, cicloheximide via EIN2-dependent or independent pathways. GCCGCC is ERF/EREBPs (AtERF1, 2, 5, 7, ERF6 (ROSE7) N.tabaccum ERF2-4, L.esculentum Pti4-6 activators and 3 and 4 reppressors) and certain AP2s (AtEBP/RAP2.3, RAP2.6) binding site;TAAGAGCCGCCACT;A. thaliana;footprintDB;Fujimoto et al., 2000
>ERE;Ethylene signalling-related;Ethylene-Responsive Element. Involved in petal senescence-related expression of GST1. This region shares significant homology with promoter sequences required for fruit-ripening E4 Et-responsiveness;AWTTCAAA;D. caryophyllus;-;Itzhaki et al., 1994
>EIN3/EIL1-3 bs i;Ethylene signalling-related;EIN3 (Ethylene-Insensitive3) / EIL1-3 (Ethylene-Insensitive3-like 1-3) binding site. EBS. EIN3 is cold-induced and negatively regulates CBFs and type A ARR5, 7 and 15 expression by binding directly to their promoters. It has been suggested that the CK receptors Arabidopsis histidine kinase2/3 and type-A Arabidopsis response regulators (ARRs) act as negative regulators in cold stress signaling through the inhibition of the ABA-dependent pathway (Jeon et al., 2010). Et-induced EIN3/EIL1 stability is mediated by the proteasomal degradation of two F-box proteins, EIN3 Binding F-box1 (EBF1) and EBF2;AYGHAYVY;A. thaliana;AGRIS;Shi et al., 2012 | Kosugi and Ohashi, 2000 | Chen et al., 2009 | Zhong et al., 2009 | Boutrot et al., 2010 | Zhang and Huang, 2011
>EIN3/EIL1-3 bs ii;Ethylene signalling-related;EIN3 (Ethylene-Insensitive3) / EIL1-3 (Ethylene-Insensitive3-like 1-3) binding site. EBS. EIN3 is cold-induced and negatively regulates CBFs and type A ARR5, 7 and 15 expression by binding directly to their promoters. It has been suggested that the CK receptors Arabidopsis histidine kinase2/3 and type-A Arabidopsis response regulators (ARRs) act as negative regulators in cold stress signaling through the inhibition of the ABA-dependent pathway (Jeon et al., 2010). Et-induced EIN3/EIL1 stability is mediated by the proteasomal degradation of two F-box proteins, EIN3 Binding F-box1 (EBF1) and EBF2;TTCAAGGGGGCATGTATCTTGAA;A. thaliana;AGRIS;"Shi et al., 2012 | Kosugi and Ohashi, 2000 | Chen et al., 2009 | Zhong et al., 2009 | Boutrot et al., 2010 |
Zhang and Huang, 2011"
>GCC-box;Ethylene signalling-related;GCC-box is A. thaliana AtERF1 to 5 binding site. AtERF1, 2 and 5 are activators but 3 and 4 are reppressors. AtERF genes are stimulated by different conditions as wounding, cold, high salinity, drought, cicloheximide via EIN2-dependent or independent pathways. ERF/EREBPs (AtERF1, 2, 5, 7, ERF6 (ROSE7) N.tabaccum ERF2-4, L.esculentum Pti4-6 activators and 3 and 4 reppressors) and certain AP2s (AtEBP/RAP2.3, RAP2.6) binding site;GCCGCC;A. thaliana;-;Fujimoto et al., 2000
>ERE ii;Ethylene signalling-related;Ethylene-Responsive Element. GCC-box. ERF/EREBPs (AtERF1, 2, 5, 7, ERF6 (ROSE7) N.tabaccum ERF2-4, L.esculentum Pti4-6 activators and 3 and 4 reppressors) and certain AP2s (AtEBP/RAP2.3, RAP2.6) binding site. Found in N. plumbaginifolia GLB glucanase, N.tabaccum ERF2-4 enhanced chitinase, L. esculentum Pti4-6- and AtERF1- and 2-induced PDF1.2, Thi2.1, and PR4 (Manners et al., 1998), certain ABA- and AtERF7-induced genes, ERF1-reppressed JA-mediated wounding-, insects- and herbivores-related promoters as VSP2, LOX3 and TAT. Phosphorylation by Pto kinase enhances Pti4 binding to GCC-box (Gu et al., 2000). OE-Pti4 plants had enhanced resistance against pathogens Erysiphe orontii and P. syringae pv. tomato. ERF1 may act as a master integrator between biotic and abiotic stress signals: under biotic stress, ERF1 binds to GCC-boxes but not DREs of JA-responsive promoters, but under heat/drought/salt treatments, ERF1 binds to DRE elements of the stress-specific set of promoters. ERF1 and AtERF2 may have overlapping functions. OE-ERF1 plants have enhanced disease resistance and water-deficit, drought, high salt and heat tolerance, increased levels of ABA (possibly through transcriptional induction of NCED), smaller stomatal aperture and higher Pro levels. ERF1 acts conversely to AtMYC2: induces expression of genes involved in defense responses against pathogens (like PR4, PR1, and PDF1.2) and represses gene expression of those genes needed for JA-mediated systemic responses to wounding, insects and herbivores;TAAGAGCCGCC;A. thaliana | N. tabaccum | L. esculentum;AGRIS  | PLACE | footprintDB;Hart et al., 1993 | Brown et al., 2003 | Koyama et al., 2013 | Cheng et al., 2013
>GARE i;Gibberellin signalling-related;GA-Responsive Element. Found in WRKY1, oxidosqualene cyclases MeJA-, GA- and yeast extract elicitation-inducible WsOSC/BS, WsOSC/LS, and ascorbate peroxidase TsApx6 gene promoters. Tissue-specific and development-related;AAACAGA;B. oleracea | H. vulgare L. | T. salsuginea | Withania somnifera | G. hirsutum;PlantCARE;Sutliff et al., 1993 | Dhar et al., 2014 | Liu et al., 2016 | Li et al., 2016
>GARE ii;Gibberellin signalling-related;GA-Responsive Element. GAMYB binding site. Found in GA-inducible alpha-amylase genes from rice, barley and wheat, seed endosperm cysteine proteinases of barley EPB-1 (also ABA-reppresed) and rice REP-1. Occurrence of TAACAAR motif in Arabidopsis GA-inducible, GA-responsive, and GA-non-responsive seed germination genes was 20, 18, and 12%, respectively. A synthetic promoter containing multiple copies of barley Amy1 / 6-4 TAACAAA motif was found GA-inducible but ABA-reppressed after transient expression in aleurone protoplasts. TAACAAA y TATCCAC are important for GA-driven expression of amy2 / 54 (Gubler and Jacobsen, 1992). GARE, Py-box and an upstream element (which couples with GARE) are required for barley EPB-1 GA-induction. ABA affects GAMYB GA-activation of EPB-1 promoter. TAACAGA, TAACGTA, and two copies of CAACTC are required for rice REP-1 OsGAMYB-driven GA-induction;RTAACARANTCYGG;A. thaliana | O.sativa | H. vulgare L. | T.aestivum;PLACE;Skriver et al., 1991 | Gubler and Jacobsen, 1992 | Cercos et al., 1999 | Sutoh and Yamauchi, 2003 | Ogawa et al., 2003
>GARE iii;Gibberellin signalling-related;GA-Responsive Element. GAMYB binding site. Found in GA-inducible alpha-amylase genes from rice, barley and wheat, seed endosperm cysteine proteinases of barley EPB-1 (also ABA-reppresed) and rice REP-1. Occurrence of TAACAAR motif in Arabidopsis GA-inducible, GA-responsive, and GA-non-responsive seed germination genes was 20, 18, and 12%, respectively. A synthetic promoter containing multiple copies of barley Amy1 / 6-4 TAACAAA motif was found GA-inducible but ABA-reppressed after transient expression in aleurone protoplasts. TAACAAA y TATCCAC are important for GA-driven expression of amy2 / 54 (Gubler and Jacobsen, 1992). GARE, Py-box and an upstream element (which couples with GARE) are required for barley EPB-1 GA-induction. ABA affects GAMYB GA-activation of EPB-1 promoter. TAACAGA, TAACGTA, and two copies of CAACTC are required for rice REP-1 OsGAMYB-driven GA-induction (alone elements did not confer GA-inducibility);TAACRKA;A. thaliana | O.sativa | H. vulgare L. | T.aestivum;PLACE | TRANSFAC | JASPAR;Skriver et al., 1991 | Gubler and Jacobsen, 1992 | Cercos et al., 1999 | Sutoh and Yamauchi, 2003 | Ogawa et al., 2003
>HvGAMYB bs;Gibberellin signalling-related;GA-Responsive Element. GAMYB binding site. Found in GA-inducible alpha-amylase genes from rice, barley and wheat, seed endosperm cysteine proteinases of barley EPB-1 (also ABA-reppresed) and rice REP-1. Occurrence of TAACAAR motif in Arabidopsis GA-inducible, GA-responsive, and GA-non-responsive seed germination genes was 20, 18, and 12%, respectively. A synthetic promoter containing multiple copies of barley Amy1 / 6-4 TAACAAA motif was found GA-inducible but ABA-reppressed after transient expression in aleurone protoplasts. TAACAAA y TATCCAC are important for GA-driven expression of amy2 / 54 (Gubler and Jacobsen, 1992). GARE, Py-box and an upstream element (which couples with GARE) are required for barley EPB-1 GA-induction. ABA affects GAMYB GA-activation of EPB-1 promoter. TAACAGA, TAACGTA, and two copies of CAACTC are required for rice REP-1 OsGAMYB-driven GA-induction (alone elements did not confer GA-inducibility);YAACSRHM;A. thaliana | O.sativa | H. vulgare L. | T.aestivum;TRANSFAC | JASPAR;Skriver et al., 1991 | Gubler and Jacobsen, 1992 | Cercos et al., 1999 | Sutoh and Yamauchi, 2003 | Ogawa et al., 2003
>TATCCAC box;Gibberellin signalling-related;Part of the conserved cis-acting response complex (GARC) that most often contain three sequence motifs, the TAACAAA box or GA-responsive element (GARE), the pyrimidine box CCTTTT (non GA-inducible Dof TF SAD binding site) and the TATCCAC box, which are necessary for a full GA response. TAACAAA y TATCCAC are important for GA-driven expression of amy2 / 54 (Gubler and Jacobsen, 1992). GAMYB interacts with SAD augmenting the binding of the latter;TATCCAC;H. vulgare L.;PLACE;Isabel-LaMoneda et al., 2003
>Py-box;Gibberellin signalling-related;Pyrimidine box. GARE, Py-box and an upstream element (which couples with GARE) are required for barley EPB-1 GA-induction. ABA affects GAMYB GA-activation of EPB-1 promoter. Required for coordinated gene expression regulated by GA and ABA. Found in Amy2/32b and cysteine proteinase EPB-1 gene promoters. CCTTTT Py-box is non GA-inducible Dof TF SAD binding site GAMYB interacts with SAD augmenting the binding of the latter;TTTTTTCC;H. vulgare L;PLACE;Cercos et al., 1999 | Isabel-LaMoneda et al., 2003
>P-box;Gibberellin signalling-related;Found in PpDhn1 and 2 gene promoters. GA and IAA may play an important role in the photoperiodic control of cold acclimation.   CCTTTT Py-box is non GA-inducible Dof TF SAD binding site GAMYB interacts with SAD augmenting the binding of the latter;CCTTTKB;P.persica;-;Isabel-LaMoneda et al., 2003 | Wisniewski et al., 2006
>CARE;Gibberellin signalling-related;TAACAGA, TAACGTA, and two copies of CAACTC are required for rice REP-1 OsGAMYB-driven GA-induction (alone elements did not confer GA-inducibility);CAACTC;O.sativa;PLACE;Sutoh and Yamauchi, 2003
>RBE;Gibberellin signalling-related;RSG (Repression of Shoot Growth, bZIP) binding site. Found in the tobacco and A. thaliana GA3 gene promoter. RSG regulates the morphology of plants by controlling the endogenous amounts of GAs;TCCAACTTGGA;A. thaliana | N. tabaccum;PLACE;Fukazawa et al., 2000
>GA-DOWN seq.;Gibberellin signalling-related;ABRE. Present in 24 A.thaliana germinating-seeds GA-reppressed genes;ACGTGTC;A. thaliana;PLACE;Ogawa et al., 2003
>ABRE i;Dehydration stimulus - ABA-dependent -related;ABA-Responsive Element. A.thaliana AREB/ABFs (bZIP | vegetative tissues AREB1/ABF1, AREB2/ABF4, and ABF3, seed ABI5, EEL, HvABI5 and rice TRAB1, EmBP-1, and TAF-1) TF binding site. Found in wheat seed late embryogenesis Em, maize ABA-inducible rab28, rice dehydrated tissues rab16, Osem (Hattori et al., 1995, Hobo et al., 1999), dehydration- and high salinity-inducible rd29b (Uno et al., 2000). ABA-responsive gene expression requires multiple ABREs or an ABRE with a coupling element as CE1 and 3 for HVA1 and 22 expression (Shen et al., 1996). ABFs are dehydration-, ABA- and high salinity-inducible and their activities are reduced in ABA-deficientaba2 and ABA-insensitive abi1 mutants but increased in ABA-hypersensitive era1 mutant. TRAB1 interacts with VP1, which enhances maize rab28 ABA-induction but not by protein-DNA interactions, and mediates ABA-induced transcription during late embryogenesis. Found in peach tree PpDhn1 gene promoter (Wisniewski et al., 2006). Found enriched in Arabidopsis and soybean promoters of cold-inducible genes, in downstream genes of 35S:DREB1A transgenic plants, and in the late-responsive cluster (27 h of treatment) of A. thaliana cold-responsive genes (Chen et al., 2002 | Hannah et al., 2005 | Maruyama et al., 2012);BACGTGKM;A. thaliana | O.sativa | H. vulgare L.;AGRIS |PlantCARE | PLACE;Busk and Pages, 1998 | Yamaguchi-Shinozaki and Shinozaki, 2006 | Gómez-Porras et al., 2007 | Maruyama et al., 2012
>ABRE ii;Dehydration stimulus - ABA-dependent -related;ABA-Responsive Element. A.thaliana AREB/ABFs (bZIP) TF binding site. Found in maize ABA-inducible rab28 gene promoter;CGCCACGT;Z. mays;-;Busk and Pages, 1998 
>CE1;Dehydration stimulus - ABA-dependent -related;Coupling element 1. Found in barley HVA22 and maize sugar-responsive ADH1 gene promoter (and other ABA-responsive genes). ZmABI4 (AP2 / ERF) TF binding site was proven to be CACCG. A. thaliana abi4 mutant is ABA-insensitive but ZmABI4 could complement its function. ABRE coupling elements in monocots differ from those in dicots (Maruyama et al., 2012);TGCCACCGG;Z.mays | H. vulgare L.;-;Shen et al., 1996 | Niu et al., 2002
>CE3;Dehydration stimulus - ABA-dependent -related;Coupling element 3. CE3 was found highly co-localized with ABRE in rice dehydration-inducible promoters. ABRE coupling elements in monocots differ from those in dicots (Maruyama et al., 2012). Found in rice Em (Hobo et al., 1999) | maize rab28 and barley HVA1;MACGCG;H. vulgare L. | O. sativa | Z. mays;-;Shen et al., 1996 | Hobo et al., 1999
>CE1 i;Dehydration stimulus - ABA-dependent -related;Coupling element 1. Found in barley HVA22 and maize sugar-responsive ADH1 gene promoter (and other ABA-responsive genes). ZmABI4 (AP2 / ERF) TF binding site was proven to be CACCG. A. thaliana abi4 mutant is ABA-insensitive but ZmABI4 could complement its function. ABRE coupling elements in monocots differ from those in dicots (Maruyama et al., 2012);SYGCYYYY;Z.mays;footprintDB;Shen et al., 1996 | Niu et al., 2002
>CE1 ii;Dehydration stimulus - ABA-dependent -related;Coupling element 1. Found in barley HVA22 and maize sugar-responsive ADH1 gene promoter (and other ABA-responsive genes). ZmABI4 (AP2 / ERF) TF binding site was proven to be CACCG. A. thaliana abi4 mutant is ABA-insensitive but ZmABI4 could complement its function. ABRE coupling elements in monocots differ from those in dicots (Maruyama et al., 2012);CRCCGCCCCS;Z.mays;footprintDB;Shen et al., 1996 | Niu et al., 2002
>CE1 iii;Dehydration stimulus - ABA-dependent -related;Coupling element 1. Found in barley HVA22 and maize sugar-responsive ADH1 gene promoter (and other ABA-responsive genes). ZmABI4 (AP2 / ERF) TF binding site was proven to be CACCG. A. thaliana abi4 mutant is ABA-insensitive but ZmABI4 could complement its function. ABRE coupling elements in monocots differ from those in dicots (Maruyama et al., 2012);CGGTGCYBYY;A. thaliana;footprintDB;Shen et al., 1996 | Niu et al., 2002
>AtABI5 bs;Dehydration stimulus - ABA-dependent -related;ABI5 binding site. Found in late embryogenesis-expressed Em1 and Em6 genes. There are ABI5-related genes also independent of ABI5 as AbZIP12/EEL. EEL compete with ABI5 for the same binding sites at AtEm1 promoter;KMYACGTBR;A. thaliana;footprintDB;Carles et al., 2002 | Bensmihen et al., 2002
>Zm/TaABI3 bs;Dehydration stimulus - ABA-dependent -related;Sph element. RY repeat. FUS3 and ABI3 binding site. Found in maize C1 and rab17, wheat Em, and rice rab16A, soybean glycinin (Gy2) gene promoters, and within RY / G box (a complex containing two RY-repeats and a G-box) of napA gene. ABI3 drives ABA-independent and -dependent activation through the dist B-box ABRE (B-box is ABA-inducible). RY sequence motif does not play a major role in VP1 or ABA regulation of Em gene in protoplast. VP1 is specifically required for expression of the maturation program in seed development;TCCATGCATGCAC;Z.mays | T.aestivum | O.sativa;PLACE;Hattori et al., 1995 | Ezcurra et al., 1999 | Reidt et al., 2000
>ABRE-like;Dehydration stimulus - ABA-dependent -related;Osem region 1. Found in rice Osem  (one of the LEA proteins). Osem motif A (TACGTGTC) is an ABRE but also allows OsVP1 binding;CGGCGGCCTCGCCACG;O.sativa;PLACE;Hattori et al., 1995
> G-box;Dehydration stimulus - ABA-dependent -related;Coupling element of ABRE. Found enriched in Arabidopsis and soybean dehydration-responsive genes;CACGTG;A. thaliana | G.max;-;Maruyama et al., 2012
>Ca2-RE;Dehydration stimulus - ABA-dependent -related;ABRE-related sequence found in Ca2+-responsive genes | CAMTAs bind to this specific ABRE motif and to ABRE-CE (both included in this consensus cis-element). usters of cold-, AtDREB1A and B co-expressed genes. Previously identified in promoters of genes responsive to cytosolic Ca2+ (Kaplan et al., 2006);MACGYGB;A. thaliana;PLACE;Kaplan et al., 2006 | Finkler et al., 2007
>Py-box;Dehydration stimulus - ABA-dependent -related;Pyrimidine box. GARE, Py-box and an upstream element (which couples with GARE) are required for barley EPB-1 GA-induction. ABA affects GAMYB GA-activation of EPB-1 promoter. Required for coordinated gene expression regulated by GA and ABA. Found in Amy2/32b and cysteine proteinase EPB-1 gene promoters. CCTTTT Py-box is non GA-inducible Dof TF SAD binding site GAMYB interacts with SAD augmenting the binding of the latter;TTTTTTCC;H. vulgare L.;PLACE;Cercos et al., 1999
>ATHB6 bs;Dehydration stimulus - ABA-dependent -related;Homeodomain-leucine zipper (HD-Zip) TF ATHB6 binding site. Water deficit, osmotic stress and ABA induces ATHB6. ABA-insensitive abi1 and 2 and ABA-deficient aba-3 mutants subjected to drought treatment. ATBH6 interacts with ABI1. OE-ATHB6 plants have ABA-insensitivity in a subset of ABI1-dependent responses. ATHB6 functions as a negative regulator downstream of ABI1 in the ABA signal transduction pathway;CAATTATTG;A. thaliana;-;Soderman et al., 1999 | Tran et al., 2004, 2007
>AtMYB2 bs;Dehydration stimulus - ABA-dependent -related; MYB recognition site for ABA- and drought- transcriptional activation. Found in rd22 gene for ABA-induction cooperatively with MYC2/rd22BP1/JIN1/JAI1. OE-AtMYB2 and OE-MYC2 plants are ABA-hypersensitive and osmotic tolerant, and several ABA-regulated genes have affected expression;CHAACNR;A. thaliana;PLACE | footprintDB;Urao et al., 1993 | Abe et al., 2003
>AtMYB2 bs ii;Dehydration stimulus - ABA-dependent -related; MYB recognition site for ABA- and drought- transcriptional activation. Found in rd22 gene for ABA-induction cooperatively with MYC2/rd22BP1/JIN1/JAI1. OE-AtMYB2 and OE-MYC2 plants are ABA-hypersensitive and osmotic tolerant, and several ABA-regulated genes have affected expression;YCHAACNR;A. thaliana;PLACE | footprintDB;Urao et al., 1993 | Abe et al., 2003
>MYB1 bs;Dehydration stimulus - ABA-dependent -related;MYB1 binding site. MYB1 is induced by dehydration. MYB binding site in ABA and AREB-inducible rd29B gene promoter (Uno et al., 2000);YCTAACTG;A. thaliana;footprintDB;Urao et al., 1993
>JIN1 bs;Dehydration stimulus - ABA-dependent -related;ZBF1/MYC2/rd22BP1/JIN1/JAI1 bs. Z-box. MYC2 is ABA-, JA- and JA-Et-related TF. MYC2 gene is induced by ABA, ABA+JA (although no synergistic effect was seen and later it was proven that ABA activates JA pathway), wounding (both local and systemic. Mutant myc2 plants are ABA-sensitive and have increased resistance to necrotrophic pathogens. OE-MYC2 plants are ABA- and JA-hypersensitive and osmotic tolerant. MYC2 is negative regulator of blue-light photomorphogenesis and of blue and far-red-light-regulated gene expression. MYC2 was ABA-induced and reported to bind CACATG motif at dehydration-responsive rd22 promoter. JIN1 represses genes involved in defense responses against pathogens (PR4, PR1, and PDF1.2) and activates JA-systemic responses to wounding, insects and herbivores (inducing VSP2, LOX3 and TAT genes). MYC2 is not sufficient to actívate JA or ABA pathways. ERF1 acts in opposite way regards both groups of genes. JA-induction of VSP2 expression was prevented in OE-ERF1 lines so Et repression of wounding-related genes occurs downstream of (or apart from) MYC2;TGACACGT;A. thaliana;footprintDB;Abe et al., 1997 | Lorenzo et al., 2004 | Yadav et al., 2005
>JAI1/JIN1 bs;Dehydration stimulus - ABA-dependent -related;ZBF1/MYC2/rd22BP1/JIN1/JAI1 bs. Z-box. MYC2 is ABA-, JA- and JA-Et-related TF. MYC2 gene is induced by ABA, ABA+JA (although no synergistic effect was seen and later it was proven that ABA activates JA pathway), wounding (both local and systemic. Mutant myc2 plants are ABA-sensitive and have increased resistance to necrotrophic pathogens. OE-MYC2 plants are ABA- and JA-hypersensitive and osmotic tolerant. MYC2 is negative regulator of blue-light photomorphogenesis and of blue and far-red-light-regulated gene expression. MYC2 was ABA-induced and reported to bind CACATG motif at dehydration-responsive rd22 promoter. JIN1 represses genes involved in defense responses against pathogens (PR4, PR1, and PDF1.2) and activates JA-systemic responses to wounding, insects and herbivores (inducing VSP2, LOX3 and TAT genes). MYC2 is not sufficient to actívate JA or ABA pathways. ERF1 acts in opposite way regards both groups of genes. JA-induction of VSP2 expression was prevented in OE-ERF1 lines so Et repression of wounding-related genes occurs downstream of (or apart from) MYC2;CACATG;A. thaliana;-;Abe et al., 1997 | Lorenzo et al., 2004 | Yadav et al., 2005
>DBPF bs;Dehydration stimulus - ABA-dependent -related;D. carota DBPF-1, -2 (Dc3 promoter-binding factor-1 and 2), and GIA1 / ABI5 bZIP TFs binding site. DBPF-1, and -2 are similar to GBF4 and 5 TFs. Found in embryo-specific and ABA-inducible D. carota LEA Dc3 gene promoter;ACACNNG;D. carota | A. thaliana;PLACE;Kim et al., 1997 | Lopez-Molina et al., 2000
>DBF1-2 bs;Dehydration stimulus - ABA-dependent -related;Maize ABA-, dehydration- and salinity stress-inducible DBF1 and 2 (DRE2-binding proteins, AP2 / ERF TF family members) binding site. Found in rab17 gene promoter for drought and ABA responsive expression. DBF1 activates ABA- and DRE2-dependent transcription of rab17 promoter. DBF2 overexpression had a repression effect downregulating not only the basal promoter activity but also the ABA effect. Both proteins failed to bind to the rab17 DRE1 cis-element core sequence (ACCGAG);ACCGAC;Z.mays;-;Kizis and Pages, 2002
>CBF4 bs;Dehydration stimulus - ABA-dependent -related;ABA- and drought- but not cold-inducible CBF4 (and other AP2 / ERF members) binding site.OE-CBF4 plants have constitutive freezing and dehydration tolerance and COR15a and COR78a induction;CCGAC;A. thaliana;-;Haake et al., 2002
>TYNY2 bs;Dehydration stimulus - ABA-dependent -related;Cold-, ABA-, drought-, mechanical wounding-, and high salinity-inducible TINY2 (AP2/ERF DREB subfamily member) binding site. DRE in vitro binding of TINY2;TACTRCCGACAT;A. thaliana;-;Wei et al., 2005
>AtERF7 bs;Dehydration stimulus - ABA-dependent -related;GCC-box. Found ABA-induced genes. AtERF7 interacts with the ABA responses-global regulator kinase PKS3 and with AtSin3 for HDA19 recruitment and a reppression role. OE-AtERF7 plants had reduced ABA sensitivity of guard cells and increased water loss. ERF/EREBPs (AtERF1, 2, 5, 7, ERF6 (ROSE7) N.tabaccum ERF2-4, L.esculentum Pti4-6 activators and 3 and 4 reppressors) and certain AP2s (AtEBP/RAP2.3, RAP2.6) binding site;GCCGCC;A. thaliana;-;Song et al., 2005
>ALFIN1 bs;Dehydration-related;Salt-inducible ALFIN1 binding site. Found in root-specific MsPRP2 gene promoter and suggests that ALFIN1 contributes to roots salt tolerance;RRGGTGKGGS;M.sativa;-;Bastola et al., 1998
>ERF1 bs;Dehydration stimulus - ABA-independent -related;AP2/ERF family member ERF1 (At3g23240) binding site. ERF1 is induced by JA, ET, JA+ET (ABA abolishes this), local and systemic biotic interaction, salt and drougth (JA and ET are required, ABA inhibits it) but not by heat or ABA. ERF1 is downstream to COI1, EIN3 (binds to PERE in ERF1 promoter) and EIN2. ERF1 may act as a master integrator between biotic and abiotic stress signals: under biotic stress, ERF1 bound to GCC boxes but not DRE elements of JA-responsive promoters, but under heat/drought/salt treatments, ERF1 bound to DRE elements of the stress-specific set of promoters. ERF1 and AtERF2 may have overlapping or redundant functions through GCC-box cis-elements. OE-ERF1 plants have enhanced disease resistance and water-deficit, drought, high salt and heat tolerance, increased levels of ABA (possibly through transcriptional induction of NCED), smaller stomatal aperture and higher Pro levels. ERF1 acts conversely to AtMYC2: induces expression of genes involved in defense responses against pathogens (like PR4, PR1, and PDF1.2) and represses gene expression of those genes needed for JA-mediated systemic responses to wounding, insects and herbivores (inducing VSP2, LOX3 and TAT genes);RCCGAC;A. thaliana;-;Cheng et al., 2013
>At CRT/DRE;Dehydration stimulus - ABA-independent -related;C-repeat/Dehydration (CRT)-, high salt-, or low-temperature-Responsive Element (DRE). DREB2A preferential binding site. Found enriched in 35S:DREB2A downstream gene promoters which are involved in dehydration, high salinity, and heat-shock stress tolerance (but not freezing stress). DREB2A expression is regulated by dehydration, high-salinity, and heat-shock but not by ABA;CCGACT;A. thaliana;-;Maruyama et al., 2012
>RD29A CRT/DRE;Dehydration stimulus - ABA-independent -related;C-repeat/Dehydration (CRT)-, high salt-, or low-temperature-Responsive Element (DRE). Essential cis-acting element for regulating RD29A induction in ABA-independent response to dehydration and cold. As RD29A induction is noticed in aba or abi mutants by both drought and cold stimuli, its expression is governed by both ABA-dependent and ABA-independent regulation, and DREB2A or CBF4 could bind to its DRE element;TACCGACAT;A. thaliana;-;Xue, 2003 | Dubouzet et al., 2003 | Sakuma et al., 2006 | Maruyama et al., 2012
>DREB2A CRT/DRE;Dehydration stimulus - ABA-independent -related;C-repeat/Dehydration (CRT)-, high salt-, or low-temperature-Responsive Element (DRE). Essential cis-acting element for regulating RD29A induction in ABA-independent response to dehydration and cold. As RD29A induction is noticed in aba or abi mutants by both drought and cold stimuli, its expression is governed by both ABA-dependent and ABA-independent regulation, and DREB2A or CBF4 could bind to its DRE element;RCCGAC;A. thaliana;-;Narusaka et al., 2003 | Sakuma et al., 2006 | Maruyama et al., 2012
>DREB2A CRT/DRE ii;Dehydration stimulus - ABA-independent -related;C-repeat/Dehydration (CRT)-, high salt-, or low-temperature-Responsive Element (DRE). Essential cis-acting element for regulating RD29A induction in ABA-independent response to dehydration and cold. As RD29A induction is noticed in aba or abi mutants by both drought and cold stimuli, its expression is governed by both ABA-dependent and ABA-independent regulation, and DREB2A or CBF4 could bind to its DRE element;TACTRCCGACAYGA;A. thaliana;-;Narusaka et al., 2003 | Sakuma et al., 2006 | Maruyama et al., 2012
>ZFHD1 bs;Dehydration stimulus - ABA-independent -related;ZFHD1 binding site. Found within the 14-bp rps1 site 1-like in dehydration-responsive erd1 gene promoter. ZFDH1 gene is induced by drought, high salinity and ABA. NAC and ZFHD1 TFs interact for enhanced expression of the erd1 gene. NAC and ZFHD1 overexpressing plants showed significantly increased drought tolerance. Some genes like erd1 do not respond to either cold or ABA treatment, suggesting the existence of another ABA-independent pathway in the dehydration stress response;CACTAAATTGTCAC;A. thaliana;-;Tran et al., 2004, 2007
>TaNAC69 bs i;Dehydration stimulus - ABA-independent -related;Cold and drought-inducible TaNAC69 (A.thaliana orthologue is NAP -No apical meristem (NAM) protein-) recongises two cis-elements;RRWRGCGTRTRKTWYACGTAAYY;T.aestivum;footprintDB;Xue et al., 2006
>TaNAC69 bs ii;Dehydration stimulus - ABA-independent -related;Cold and drought-inducible TaNAC69 (A.thaliana orthologue is NAP -No apical meristem (NAM) protein-) recongises two cis-elements;RGTSKTTAWCYTTTRYACGTMWCT;T.aestivum;footprintDB;Xue et al., 2006
>NAC bs;Dehydration stimulus - ABA-independent -related;ANAC019, ANAC055, and ANAC072/RD26-binding site. AtNAC019, 055, and 072 are drought-, high salinity-, and ABA-inducible.  Found in erd1 promoter. OE-NAC plants show drought tolerance and ABA- and stress-inducible gene expression but no expression of erd1 was detected (the needed coupling TF was discovered: ZFHD1). NAC and ZFHD1 TFs interact for enhanced expression of the erd1 gene. Some genes like erd1 do not respond to either cold or ABA treatment, suggesting the existence of another ABA-independent pathway in the dehydration stress response;ACACGCATGT;A. thaliana;-;Tran et al., 2004, 2007
>as-1-like motif;Cytokinin signalling-related;Cis-element for CK responsiveness. Found in cucumber CK- and light-inducible hydroxypyruvate reductase (hprA) gene promoter, TGACG motif is present in plant other promoters;AAATGACGAAAATGC;C.sativus;PLACE;Jin et al., 1998
>ARR1 bs;Cytokinin signalling-related; ARR1 binding site. AGAT(T/C) is the core motif for type B ARR1/2/10/11 in vitro binding. Found in A. thaliana ARR6 and rice non-symbiotic haemoglobin-2 (NSHB) gene promoter. Substantially overrepresented in the putative regulatory regions of the CK-induced genes (Bhargava et al., 2013). Histidin kinase CRE1 is a CK sensor and could stimulate ARR1;AAGATY;A. thaliana;PLACE;Sakai et al., 2001 | Ross et al., 2004 | Taniguchi et al., 2007 | Bhargava et al., 2013
>CPB sequence;Cytokinin signalling-related;Sequence critical for in vitro Cytokinin-enhanced Protein Binding (CPB). Found in NADPH-protochlorophyllide oxidoreductase (POR) gene promoter;TATTAG;C.sativus;PLACE;Fusada et al., 2005
>EIRE;Biotic stimulus-related;Elicitor-Responsive Element. Elicitor-inducible WRKY1 and 2 binding site. Found in parsley PR1-1 and 2 gene promoters;TTGACC;A. thaliana | P. crispum | N. tabaccum;PLACE;Rushton et al., 1996
>EIRE ii;Biotic stimulus-related;Elicitor-Responsive Element. Elicitor-inducible WRKY1 and 2 binding site. Found in parsley PR1-1 and 2 gene promoters;TTCGACC;A. thaliana | P. crispum | N. tabaccum;PLACE;Rushton et al., 1996
>LeCp bs;Biotic stimulus-related;Dual-function LeCp in vitro binding site. Found in LeAcs2 gene promoter which is EIX-inducible (Ethylene-Inducing Xylanase, EIX is a fungal elicitor that elicits Et biosynthesis in tomato and tobacco leaves by induction of Acs expression). LeCp also has enzymatic activity and, upon elicitor signalling, a small ubiquitin-related modifier protein binds to it enabling entrance into the nucleus and transcriptional factor activity;TAAAATAT;L. esculentum | N. tabaccum;PLACE;Matarasso et al., 2005
>PR-10a SEBF bs;Biotic stimulus-related;Potato silencing element binding factor (SEBF) binding site. Found in pathogen- or elicitor-inducible PR-10a. But PR-10a is repressed in a silencing element-dependent manner when overexpression of SEBF in protoplasts;YTGTCWC;S.tuberosum;PLACE;Boyle and Brisson, 2001
>JAI1/JIN1 bs;Biotic stimulus-related;ZBF1/MYC2/rd22BP1/JIN1/JAI1 bs. Z-box. MYC2 is ABA-, JA- and JA-Et-related TF. MYC2 gene is induced by ABA, ABA+JA (although no synergistic effect was seen and later it was proven that ABA activates JA pathway), wounding (both local and systemic. Mutant myc2 plants are ABA-sensitive and have increased resistance to necrotrophic pathogens. OE-MYC2 plants are ABA- and JA-hypersensitive and osmotic tolerant. MYC2 is negative regulator of blue-light photomorphogenesis and of blue and far-red-light-regulated gene expression. MYC2 was ABA-induced and reported to bind CACATG motif at dehydration-responsive rd22 promoter. JIN1 represses genes involved in defense responses against pathogens (PR4, PR1, and PDF1.2) and activates JA-systemic responses to wounding, insects and herbivores (inducing VSP2, LOX3 and TAT genes). MYC2 is not sufficient to actívate JA or ABA pathways. ERF1 acts in opposite way regards both groups of genes. JA-induction of VSP2 expression was prevented in OE-ERF1 lines so Et repression of wounding-related genes occurs downstream of (or apart from) MYC2;CACATG;A. thaliana;-;Abe et al., 1997 | Lorenzo et al., 2004 | Yadav et al., 2005
>JIN1 bs;Biotic stimulus-related;ZBF1/MYC2/rd22BP1/JIN1/JAI1 bs. Z-box. MYC2 is ABA-, JA- and JA-Et-related TF. MYC2 gene is induced by ABA, ABA+JA (although no synergistic effect was seen and later it was proven that ABA activates JA pathway), wounding (both local and systemic. Mutant myc2 plants are ABA-sensitive and have increased resistance to necrotrophic pathogens. OE-MYC2 plants are ABA- and JA-hypersensitive and osmotic tolerant. MYC2 is negative regulator of blue-light photomorphogenesis and of blue and far-red-light-regulated gene expression. MYC2 was ABA-induced and reported to bind CACATG motif at dehydration-responsive rd22 promoter. JIN1 represses genes involved in defense responses against pathogens (PR4, PR1, and PDF1.2) and activates JA-systemic responses to wounding, insects and herbivores (inducing VSP2, LOX3 and TAT genes). MYC2 is not sufficient to actívate JA or ABA pathways. ERF1 acts in opposite way regards both groups of genes. JA-induction of VSP2 expression was prevented in OE-ERF1 lines so Et repression of wounding-related genes occurs downstream of (or apart from) MYC2;TGACACGT;A. thaliana;footprintDB;Abe et al., 1997 | Lorenzo et al., 2004 | Yadav et al., 2005
>JAI1/JIN1 bs ii;Biotic stimulus-related;ZBF1/MYC2/rd22BP1/JIN1/JAI1 bs. Z-box. MYC2 is ABA-, JA- and JA-Et-related TF. MYC2 gene is induced by ABA, ABA+JA (although no synergistic effect was seen and later it was proven that ABA activates JA pathway), wounding (both local and systemic. Mutant myc2 plants are ABA-sensitive and have increased resistance to necrotrophic pathogens. OE-MYC2 plants are ABA- and JA-hypersensitive and osmotic tolerant. MYC2 is negative regulator of blue-light photomorphogenesis and of blue and far-red-light-regulated gene expression. MYC2 was ABA-induced and reported to bind CACATG motif at dehydration-responsive rd22 promoter. JIN1 represses genes involved in defense responses against pathogens (PR4, PR1, and PDF1.2) and activates JA-systemic responses to wounding, insects and herbivores (inducing VSP2, LOX3 and TAT genes). MYC2 is not sufficient to actívate JA or ABA pathways. ERF1 acts in opposite way regards both groups of genes. JA-induction of VSP2 expression was prevented in OE-ERF1 lines so Et repression of wounding-related genes occurs downstream of (or apart from) MYC2;AACGTG;A. thaliana;-;Guerineau et al., 2003 | Lorenzo et al., 2004
>GT-1 i;Biotic stimulus-related;"Cis-acting regulatory element required for rapid response to pathogen
attack, salinity and SA inducible gene expression. Found in soybean calmodulin SCaM-4 gene promoter";GGTTAA;G. max;-;Park et al., 2004
>GT-1 ii;Biotic stimulus-related;"Cis-acting regulatory element required for rapid response to pathogen
attack, salinity and SA inducible gene expression. Found in soybean calmodulin SCaM-4 gene promoter";GAAAAA;G. max;-;Park et al., 2004
>AtWRKY18 bs;Biotic stimulus-related;W-box. Found in a chromosomic zone with 4 pathogen- and SA-induced RLK kinase genes and in tobacco class I basic chitinase gene CHN48, and A.thaliana NPR1 gene, recognized specifically by SA-induced WRKY TFs. A cluster of WRKY binding sites act as negative regulatory elements for the inducible expression of AtWRKY18: Physical and functional interactions were proven for WRKY18, 40 and 60 proteins, and their contributionto different pathogens tolerance was determined;RGTCAAMG;A. thaliana | N. tabaccum;PLACE  | footprintDB;Maleck et al., 2000 | Du and Chen, 2000 | Yu et al., 2001 | Chen et al., 2002 | Yamamoto et al., 2004 | Zheng et al., 2006 | Xu et al., 2006
>AtWRKY18 bs ii;Biotic stimulus-related;W-box. Found in a chromosomic zone with 4 pathogen- and SA-induced RLK kinase genes and in tobacco class I basic chitinase gene CHN48, and A.thaliana NPR1 gene, recognized specifically by SA-induced WRKY TFs. A cluster of WRKY binding sites act as negative regulatory elements for the inducible expression of AtWRKY18: Physical and functional interactions were proven for WRKY18, 40 and 60 proteins, and their contributionto different pathogens tolerance was determined;YTGACY;A. thaliana | N. tabaccum;PLACE  | footprintDB;Maleck et al., 2000 | Du and Chen, 2000 | Yu et al., 2001 | Chen et al., 2002 | Yamamoto et al., 2004 | Zheng et al., 2006 | Xu et al., 2006
>SA sequence;Biotic stimulus-related;Found in A.thaliana PDF1.2 and tobacco SA-inducible PR-2d gene promoters;TTCGAC;A. thaliana | N. tabaccum;-;Shah and Klessig, 1996
>ERE;Biotic stimulus-related;Ethylene-Responsive Element. GCC-box. ERF/EREBPs (AtERF1, 2, 5, 7, ERF6 (ROSE7) N.tabaccum ERF2-4, L.esculentum Pti4-6 activators and 3 and 4 reppressors) and certain AP2s (AtEBP/RAP2.3, RAP2.6) binding site. Found in N. plumbaginifolia GLB glucanase, N.tabaccum ERF2-4 enhanced chitinase, L. esculentum Pti4-6- and AtERF1- and 2-induced PDF1.2, Thi2.1, and PR4 (Manners et al., 1998), certain ABA- and AtERF7-induced genes, ERF1-reppressed JA-mediated wounding-, insects- and herbivores-related promoters as VSP2, LOX3 and TAT. Phosphorylation by Pto kinase enhances Pti4 binding to GCC-box (Gu et al., 2000). OE-Pti4 plants had enhanced resistance against pathogens Erysiphe orontii and P. syringae pv. tomato. ERF1 may act as a master integrator between biotic and abiotic stress signals: under biotic stress, ERF1 binds to GCC-boxes but not DREs of JA-responsive promoters, but under heat/drought/salt treatments, ERF1 binds to DRE elements of the stress-specific set of promoters. ERF1 and AtERF2 may have overlapping functions. OE-ERF1 plants have enhanced disease resistance and water-deficit, drought, high salt and heat tolerance, increased levels of ABA (possibly through transcriptional induction of NCED), smaller stomatal aperture and higher Pro levels. ERF1 acts conversely to AtMYC2: induces expression of genes involved in defense responses against pathogens (like PR4, PR1, and PDF1.2) and represses gene expression of those genes needed for JA-mediated systemic responses to wounding, insects and herbivores;TAAGAGCCGCC;A. thaliana | N. tabaccum | L. esculentum;AGRIS  | PLACE;Hart et al., 1993 | Brown et al., 2003 | Koyama et al., 2013 | Cheng et al., 2013
>GCC-box;Biotic stimulus-related;Ethylene-Responsive Element. GCC-box. ERF/EREBPs (AtERF1, 2, 5, 7, ERF6 (ROSE7) N.tabaccum ERF2-4, L.esculentum Pti4-6 activators and 3 and 4 reppressors) and certain AP2s (AtEBP/RAP2.3, RAP2.6) binding site. Found in N. plumbaginifolia GLB glucanase, N.tabaccum ERF2-4 enhanced chitinase, L. esculentum Pti4-6- and AtERF1- and 2-induced PDF1.2, Thi2.1, and PR4 (Manners et al., 1998), certain ABA- and AtERF7-induced genes, ERF1-reppressed JA-mediated wounding-, insects- and herbivores-related promoters as VSP2, LOX3 and TAT. Phosphorylation by Pto kinase enhances Pti4 binding to GCC-box (Gu et al., 2000). OE-Pti4 plants had enhanced resistance against pathogens Erysiphe orontii and P. syringae pv. tomato. ERF1 may act as a master integrator between biotic and abiotic stress signals: under biotic stress, ERF1 binds to GCC-boxes but not DREs of JA-responsive promoters, but under heat/drought/salt treatments, ERF1 binds to DRE elements of the stress-specific set of promoters. ERF1 and AtERF2 may have overlapping functions. OE-ERF1 plants have enhanced disease resistance and water-deficit, drought, high salt and heat tolerance, increased levels of ABA (possibly through transcriptional induction of NCED), smaller stomatal aperture and higher Pro levels. ERF1 acts conversely to AtMYC2: induces expression of genes involved in defense responses against pathogens (like PR4, PR1, and PDF1.2) and represses gene expression of those genes needed for JA-mediated systemic responses to wounding, insects and herbivores;GCCGCC;A. thaliana | N. tabaccum | L. esculentum;-;Hart et al., 1993 | Brown et al., 2003 | Koyama et al., 2013 | Cheng et al., 2013
>TL1;Biotic stimulus-related;Consensus sequence overrepresented in the promoter regions of all 13 NPR1-responsive ER-resident genes surveyed (NPR1 is Nonexpressor of pathogenesis-related genes 1, also known as NIM1);CTGAAGAAGAA;A. thaliana;PLACE;Wang et al., 2005
>TDBA12 bs;Biotic stimulus-related;Elicitor response element found in tobacco basic class I chitinase gene (CHN50) for TMV infection- and SA-activated TDBA12 (WRKY) TF binding;TGACTTTCTGAC;N. tabaccum;PLACE;Yang et al., 1999
>TacBBF bs;Biotic stimulus-related;TacBBF (TAC box binding factor) binding site. Found in tobacco 5-epi-aristolochene synthase (EAS4) gene involved in sesquiterpene phytoalexin biosynthesis and required for elicitor-inducibility;ACTCTACAGTACTC;N. tabaccum;PLACE;Newman et al., 1998
>HSRE;Biotic stimulus-related;HSR203J gene Responsive Element. Tobacco HSR203J is a molecular marker of the hypersensitive response, highly induced during early steps of incompatible plant/pathogen interactions;CAAAATTTTGTA;N. tabaccum;PLACE;Pontier et al., 2001
>JA G-box ii;Jasmonic acid signalling-related;JA-inducible JAMYC2 and 10 binding site. T/G-box. Found in tomato JA-induced proteinase inhibitor II (pin2) and leucine aminopeptidase (LAP) gene promoters. Same motif acts as AtMYC2/JIN1 binding site in A. thaliana;AACGTG;L. esculentum | A. thaliana;PLACE;Boter et al., 2004
>JA G-box;Jasmonic acid signalling-related;Binding site of Arabidopsis bZIP TFs. G-box require at least one additional cis-acting element for appropriate transcriptional activation;CACGTGGC;A. thaliana;-;Menkens et al., 1995
>JA sequence;Jasmonic acid signalling-related;Found in JA-inducible A.thaliana PDF1.2 and soybean vegetative storage protein-acid phosphatase VspB gene promoter;AAATGTTGT;A. thaliana | G.max;-;Mason et al., 1993
>JARE;Jasmonic acid signalling-related;OsROS-bZIP bs iii or JARE (JA-Responsive Element) motif. TGA-type bZIP, cold- and H2O2-inducible (but not ABA-) ROS-bZIP, and OBF (Ocs element Binding Factor, bZIP) binding site. Found in both pathogen and plant promoters, especially in: SA-, auxin- or H2O2-inducible GST6, Agrobacterium OCS (octopine synthase), A.thaliana PDF1.2 and MeJA- and wound-inducible LOX1, and H.vulgare LOX (lipoxygenase). GST6 promoter also contains OBP1, 4, 5 (OBF-binding protein) binding site and OBP1 stimulates OBFs binding (Zhang et al., 1995). Part of the second highly conserved group of motifs in cold- or H2O2-responsive promoters of rice japonica chilling tolerant cultivar (potentially CBF-independent regulon);TGACG;A. thaliana | A. tumefaciens | H.vulgare L. | O.sativa;-;Bouchez et al., 1989 | Chen et al., 1996 | Rouster et al., 1997 | Chen and Singh, 1999 | Cheng et al., 2007
>MeJARE;Jasmonic acid signalling-related;MeJA-responsive element |  found in tomato lipoxygenase (LOX) gene for expression during development;GATACANNAATNTGATG;L. esculentum;PLACE;Beaudoin and Rothstein, 1997
>JAI1/JIN1 bs;Jasmonic acid signalling-related;ZBF1/MYC2/rd22BP1/JIN1/JAI1 bs. Z-box. MYC2 is ABA-, JA- and JA-Et-related TF. MYC2 gene is induced by ABA, ABA+JA (although no synergistic effect was seen and later it was proven that ABA activates JA pathway), wounding (both local and systemic. Mutant myc2 plants are ABA-sensitive and have increased resistance to necrotrophic pathogens. OE-MYC2 plants are ABA- and JA-hypersensitive and osmotic tolerant. MYC2 is negative regulator of blue-light photomorphogenesis and of blue and far-red-light-regulated gene expression. MYC2 was ABA-induced and reported to bind CACATG motif at dehydration-responsive rd22 promoter. JIN1 represses genes involved in defense responses against pathogens (PR4, PR1, and PDF1.2) and activates JA-systemic responses to wounding, insects and herbivores (inducing VSP2, LOX3 and TAT genes). MYC2 is not sufficient to actívate JA or ABA pathways. ERF1 acts in opposite way regards both groups of genes. JA-induction of VSP2 expression was prevented in OE-ERF1 lines so Et repression of wounding-related genes occurs downstream of (or apart from) MYC2;CACATG;A. thaliana;-;Abe et al., 1997 | Lorenzo et al., 2004 | Yadav et al., 2005
>JIN1 bs;Jasmonic acid signalling-related;ZBF1/MYC2/rd22BP1/JIN1/JAI1 bs. Z-box. MYC2 is ABA-, JA- and JA-Et-related TF. MYC2 gene is induced by ABA, ABA+JA (although no synergistic effect was seen and later it was proven that ABA activates JA pathway), wounding (both local and systemic. Mutant myc2 plants are ABA-sensitive and have increased resistance to necrotrophic pathogens. OE-MYC2 plants are ABA- and JA-hypersensitive and osmotic tolerant. MYC2 is negative regulator of blue-light photomorphogenesis and of blue and far-red-light-regulated gene expression. MYC2 was ABA-induced and reported to bind CACATG motif at dehydration-responsive rd22 promoter. JIN1 represses genes involved in defense responses against pathogens (PR4, PR1, and PDF1.2) and activates JA-systemic responses to wounding, insects and herbivores (inducing VSP2, LOX3 and TAT genes). MYC2 is not sufficient to actívate JA or ABA pathways. ERF1 acts in opposite way regards both groups of genes. JA-induction of VSP2 expression was prevented in OE-ERF1 lines so Et repression of wounding-related genes occurs downstream of (or apart from) MYC2;TGACACGT;A. thaliana;footprintDB;Abe et al., 1997 | Lorenzo et al., 2004 | Yadav et al., 2005
>JAI1/JIN1 bs ii;Jasmonic acid signalling-related;ZBF1/MYC2/rd22BP1/JIN1/JAI1 bs. Z-box. MYC2 is ABA-, JA- and JA-Et-related TF. MYC2 gene is induced by ABA, ABA+JA (although no synergistic effect was seen and later it was proven that ABA activates JA pathway), wounding (both local and systemic. Mutant myc2 plants are ABA-sensitive and have increased resistance to necrotrophic pathogens. OE-MYC2 plants are ABA- and JA-hypersensitive and osmotic tolerant. MYC2 is negative regulator of blue-light photomorphogenesis and of blue and far-red-light-regulated gene expression. MYC2 was ABA-induced and reported to bind CACATG motif at dehydration-responsive rd22 promoter. JIN1 represses genes involved in defense responses against pathogens (PR4, PR1, and PDF1.2) and activates JA-systemic responses to wounding, insects and herbivores (inducing VSP2, LOX3 and TAT genes). MYC2 is not sufficient to actívate JA or ABA pathways. ERF1 acts in opposite way regards both groups of genes. JA-induction of VSP2 expression was prevented in OE-ERF1 lines so Et repression of wounding-related genes occurs downstream of (or apart from) MYC2;AACGTG;A. thaliana;-;Guerineau et al., 2003 | Lorenzo et al., 2004
>MYB4 bs;Jasmonic acid signalling-related;R2R3-MYB binding site. Found in P. crispum light-responsive CHS, PAL and 4CL gene promoters. PcMYB1 binding site. AtMYB4 is an UV-B-, JA-, SA-, and wounding- responsive nuclear transcriptional repressor. MYB4 mRNA is UV-B-reduced. KO-MYB4 plants had higher levels of UV-protective sinapate esters (which correlates with enhanced expression of 4CL) and were more tolerant to UV-B light;AMCWAMC;A. thaliana | P. crispum;-;Feldbrügge et al., 1997 | Rushton and Somssich, 1998 | Jin et al., 2000
>GCC-box;Jasmonic acid signalling-related;Ethylene-Responsive Element. GCC-box. ERF/EREBPs (AtERF1, 2, 5, 7, ERF6 (ROSE7) N.tabaccum ERF2-4, L.esculentum Pti4-6 activators and 3 and 4 reppressors) and certain AP2s (AtEBP/RAP2.3, RAP2.6) binding site. Found in N. plumbaginifolia GLB glucanase, N.tabaccum ERF2-4 enhanced chitinase, L. esculentum Pti4-6- and AtERF1- and 2-induced PDF1.2, Thi2.1, and PR4 (Manners et al., 1998), certain ABA- and AtERF7-induced genes, ERF1-reppressed JA-mediated wounding-, insects- and herbivores-related promoters as VSP2, LOX3 and TAT. Phosphorylation by Pto kinase enhances Pti4 binding to GCC-box (Gu et al., 2000). OE-Pti4 plants had enhanced resistance against pathogens Erysiphe orontii and P. syringae pv. tomato. ERF1 may act as a master integrator between biotic and abiotic stress signals: under biotic stress, ERF1 binds to GCC-boxes but not DREs of JA-responsive promoters, but under heat/drought/salt treatments, ERF1 binds to DRE elements of the stress-specific set of promoters. ERF1 and AtERF2 may have overlapping functions. OE-ERF1 plants have enhanced disease resistance and water-deficit, drought, high salt and heat tolerance, increased levels of ABA (possibly through transcriptional induction of NCED), smaller stomatal aperture and higher Pro levels. ERF1 acts conversely to AtMYC2: induces expression of genes involved in defense responses against pathogens (like PR4, PR1, and PDF1.2) and represses gene expression of those genes needed for JA-mediated systemic responses to wounding, insects and herbivores;GCCGCC;A. thaliana | N. tabaccum | L. esculentum;-;Hart et al., 1993 | Brown et al., 2003 | Koyama et al., 2013 | Cheng et al., 2013
>Stress RE;Jasmonic acid signalling-related;L-box. Stress responsive element present in tobacco LTR promoter of Tto1 retrotransposon, involved in responsiveness to tissue culture, wounding, MeJA and fungal elicitors;TGGTAGGTGAGAT;N. tabaccum;PLACE;Takeda et al., 1999
>JERE;Jasmonic acid signalling-related;JA- and fungal-responsive element. ORCA1-3 (Cctadecanoid-Responsive Catharanthus AP2s) TFs binding site. GCC-like motif. Found in Madagascar periwinkle Str (Strictosidine synthase) gene promoter for MeJA and elicitor responsive expression;CTCTTAGACCGCCTTCTTTGAAAG;Catharanthus roseus;PLACE;Menke et al., 1999
>wound-inducible nuclear protein bs;Wounding stimulus-related;Binding site of wound-inducible nuclear protein from wounded tomato leaves. Found in the promoter region of a protease inhibitor IIK gene from potato;AAGCGTAAGT;S.tuberosum;PLACE;Palm et al., 1990
>JARE;Wounding stimulus-related;OsROS-bZIP bs iii or JARE (JA-Responsive Element) motif. TGA-type bZIP, cold- and H2O2-inducible (but not ABA-) ROS-bZIP, and OBF (Ocs element Binding Factor, bZIP) binding site. Found in both pathogen and plant promoters, especially in: SA-, auxin- or H2O2-inducible GST6, Agrobacterium OCS (octopine synthase), A.thaliana PDF1.2 and MeJA- and wound-inducible LOX1, and H.vulgare LOX (lipoxygenase). GST6 promoter also contains OBP1, 4, 5 (OBF-binding protein) binding site and OBP1 stimulates OBFs binding (Zhang et al., 1995). Part of the second highly conserved group of motifs in cold- or H2O2-responsive promoters of rice japonica chilling tolerant cultivar (potentially CBF-independent regulon);TGACG;A. thaliana | A. tumefaciens | H.vulgare L. | O.sativa;-;Bouchez et al., 1989 | Chen et al., 1996 | Rouster et al., 1997 | Chen and Singh, 1999 | Cheng et al., 2007
>MeJARE;Wounding stimulus-related;MeJA-responsive element. Found in tomato lipoxygenase (LOX) gene for expression during development;GATACANNAATNTGATG;L. esculentum;PLACE;Beaudoin and Rothstein, 1997
>GCC-box;Wounding stimulus-related;Ethylene-Responsive Element. GCC-box. ERF/EREBPs (AtERF1, 2, 5, 7, ERF6 (ROSE7) N.tabaccum ERF2-4, L.esculentum Pti4-6 activators and 3 and 4 reppressors) and certain AP2s (AtEBP/RAP2.3, RAP2.6) binding site. Found in N. plumbaginifolia GLB glucanase, N.tabaccum ERF2-4 enhanced chitinase, L. esculentum Pti4-6- and AtERF1- and 2-induced PDF1.2, Thi2.1, and PR4 (Manners et al., 1998), certain ABA- and AtERF7-induced genes, ERF1-reppressed JA-mediated wounding-, insects- and herbivores-related promoters as VSP2, LOX3 and TAT. Phosphorylation by Pto kinase enhances Pti4 binding to GCC-box (Gu et al., 2000). OE-Pti4 plants had enhanced resistance against pathogens Erysiphe orontii and P. syringae pv. tomato. ERF1 may act as a master integrator between biotic and abiotic stress signals: under biotic stress, ERF1 binds to GCC-boxes but not DREs of JA-responsive promoters, but under heat/drought/salt treatments, ERF1 binds to DRE elements of the stress-specific set of promoters. ERF1 and AtERF2 may have overlapping functions. OE-ERF1 plants have enhanced disease resistance and water-deficit, drought, high salt and heat tolerance, increased levels of ABA (possibly through transcriptional induction of NCED), smaller stomatal aperture and higher Pro levels. ERF1 acts conversely to AtMYC2: induces expression of genes involved in defense responses against pathogens (like PR4, PR1, and PDF1.2) and represses gene expression of those genes needed for JA-mediated systemic responses to wounding, insects and herbivores;GCCGCC;A. thaliana | N. tabaccum | L. esculentum;-;Hart et al., 1993 | Brown et al., 2003 | Koyama et al., 2013 | Cheng et al., 2013
>JAI1/JIN1 bs;Wounding stimulus-related;ZBF1/MYC2/rd22BP1/JIN1/JAI1 bs. Z-box. MYC2 is ABA-, JA- and JA-Et-related TF. MYC2 gene is induced by ABA, ABA+JA (although no synergistic effect was seen and later it was proven that ABA activates JA pathway), wounding (both local and systemic. Mutant myc2 plants are ABA-sensitive and have increased resistance to necrotrophic pathogens. OE-MYC2 plants are ABA- and JA-hypersensitive and osmotic tolerant. MYC2 is negative regulator of blue-light photomorphogenesis and of blue and far-red-light-regulated gene expression. MYC2 was ABA-induced and reported to bind CACATG motif at dehydration-responsive rd22 promoter. JIN1 represses genes involved in defense responses against pathogens (PR4, PR1, and PDF1.2) and activates JA-systemic responses to wounding, insects and herbivores (inducing VSP2, LOX3 and TAT genes). MYC2 is not sufficient to actívate JA or ABA pathways. ERF1 acts in opposite way regards both groups of genes. JA-induction of VSP2 expression was prevented in OE-ERF1 lines so Et repression of wounding-related genes occurs downstream of (or apart from) MYC2;CACATG;A. thaliana;-;Abe et al., 1997 | Lorenzo et al., 2004 | Yadav et al., 2005
>WRE;Wounding stimulus-related;Wound-responsive element. Found in the promoter region of cucumber ascorbate oxidase gene CsAAO1;AAWGTATCSA;C.sativus;PLACE;Palm et al., 1990
>Stress RE;Wounding stimulus-related;L-box. Stress responsive element present in tobacco LTR promoter of Tto1 retrotransposon, involved in responsiveness to tissue culture, wounding, MeJA and fungal elicitors;TGGTAGGTGAGAT;N. tabaccum;PLACE;Takeda et al., 1999
>AGP1 bs;Wounding stimulus-related;AGP1 binding site in wound-inducible NtMYB2 gene;HCAGATCTAB;N. tabaccum;footprintDB;Sugimoto et al., 2003
>ERF3 W-box;Wounding stimulus-related;Found in transcriptional repressor ERF3 gene promoter in tobacco. It could be involved in activation of ERF3 gene by wounding;TGACY;N. tabaccum;PLACE; Nishiuchi et al., 2004
>WAR;Wounding stimulus-related;Wounding activating region in B.napus extA extensin gene. AACGTGT is defined as the QAR motif (Quantitative activator region);GTACGTGTTATAAAACGTGT;B.napus;PLACE;Elliott and Shirsat, 1998
>TCA-1 bs;Salicylic acid signalling-related;TCA-1 (tobbaco nuclear protein 1) binding site. Related to salicylic acid-inducible expression of many genes. Found in nopaline synthase (nos) gene and barley beta-1,3-glucanase and in over 30 different plant stress-inducible genes. The similar sequence TCATTTCTT was found in tobacco Tnt1 retrotransposon promoter;TCATCTTCTT;N. tabaccum | H.vulgare L. | A. tumefaciens;PLACE;Hennig et al., 1993 | Goldsbrough et al., 1993 | Kim et al., 1994
>GT-1;Salicylic acid signalling-related;"Cis-acting regulatory element required for rapid response to pathogen
attack, salinity and SA inducible gene expression. Found in soybean calmodulin SCaM-4 gene promoter";GGTTAA;G. max;-;Park et al., 2004
>GT-1 ii;Salicylic acid signalling-related;"Cis-acting regulatory element required for rapid response to pathogen
attack, salinity and SA inducible gene expression. Found in soybean calmodulin SCaM-4 gene promoter";GAAAAA;G. max;-;Park et al., 2004
>TCA;Salicylic acid signalling-related;Cis-acting regulatory element involved in SA responsiveness;TCAGAAGAGG;N. tabaccum | H. vulgare L. | A. tuumefaciens;-;Hennig et al., 1993 | Goldsbrough et al., 1993 | Kim et al., 1994
>TCA-element;Salicylic acid signalling-related;Cis-acting regulatory element involved in SA responsiveness;CCATCTTTTT;N. tabaccum | H. vulgare L. | A. tuumefaciens;-;Hennig et al., 1993 | Goldsbrough et al., 1993 | Kim et al., 1994
>OBP bs;Salicylic acid signalling-related;OBP1, 4, and 5 (OBF binding proteins) binding site. Found in A.thaliana SA-, auxin- or H2O2-inducible GST6 gene promoter. GST6 promoter also contains OBF (Ocs element binding site) and OBP1 stimulates OBFs binding (Zhang et al., 1995);TACACTTTTGG;A. thaliana;PLACE | AGRIS;Chen et al., 1996
>MYB4 bs;Salicylic acid signalling-related;R2R3-MYB binding site. Found in P. crispum light-responsive CHS, PAL and 4CL gene promoters. PcMYB1 binding site. AtMYB4 is an UV-B-, JA-, SA-, and wounding- responsive nuclear transcriptional repressor. MYB4 mRNA is UV-B-reduced. KO-MYB4 plants had higher levels of UV-protective sinapate esters (which correlates with enhanced expression of 4CL) and were more tolerant to UV-B light;AMCWAMC;A. thaliana | P. crispum;-;Feldbrügge et al., 1997 | Rushton and Somssich, 1998 | Jin et al., 2000
>SA sequence;Salicylic acid signalling-related;Found in A.thaliana PDF1.2 and tobacco SA-inducible PR-2d gene promoters;TTCGAC;A. thaliana | N. tabaccum;-;Shah and Klessig, 1996
>OBP3 bs;Salicylic acid signalling-related;SA-inducible OBP3 (OBF-binding protein 3 or AtDof3.6) binding site. OE-OBP3 plants showed growth defects. Several ORGs (OBP3-responsive genes) were found, including AtExt1 (ORG5), and their SA-upregulation and JA-downregulation were proven. ORG1 to 3 gene promoters contain the highest number of potential Dof-binding sites;WAAAG;A. thaliana;-;Kang et al., 2003
>OBF bs;Salicylic acid signalling-related;Ocs element. OBF (Ocs element Binding Factor, bZIP) binding site. Found in both pathogen and plant promoters, especially in: SA-, auxin- or H2O2-inducible GST6, Agrobacterium OCS (octopine synthase). Mutation of the ocs element does not abolish expression. GST6 promoter also contains OBP1, 4, 5 (OBF-binding protein) binding site and OBP1 stimulates OBFs binding (Zhang et al., 1995);ATCTTATGTCATTGATGACGACCTCC;A. thaliana | A. tumefaciens | N. tabaccum;AGRIS;Bouchez et al., 1989 | Chen et al., 1996 | Chen and Singh, 1999
>AtWRKY18 bs;Salicylic acid signalling-related;W-box. Found in a chromosomic zone with 4 pathogen- and SA-induced RLK kinase genes and in tobacco class I basic chitinase gene CHN48, and A.thaliana NPR1 gene, recognized specifically by SA-induced WRKY TFs. A cluster of WRKY binding sites act as negative regulatory elements for the inducible expression of AtWRKY18: Physical and functional interactions were proven for WRKY18, 40 and 60 proteins, and their contributionto different pathogens tolerance was determined;RGTCAAMG;A. thaliana | N. tabaccum;PLACE  | footprintDB;Maleck et al., 2000 | Du and Chen, 2000 | Yu et al., 2001 | Chen et al., 2002 | Yamamoto et al., 2004 | Zheng et al., 2006 | Xu et al., 2006
>AtWRKY18 bs ii;Salicylic acid signalling-related;W-box. Found in a chromosomic zone with 4 pathogen- and SA-induced RLK kinase genes and in tobacco class I basic chitinase gene CHN48, and A.thaliana NPR1 gene, recognized specifically by SA-induced WRKY TFs. A cluster of WRKY binding sites act as negative regulatory elements for the inducible expression of AtWRKY18: Physical and functional interactions were proven for WRKY18, 40 and 60 proteins, and their contributionto different pathogens tolerance was determined;TTGACY;A. thaliana | N. tabaccum;PLACE  | footprintDB;Maleck et al., 2000 | Du and Chen, 2000 | Yu et al., 2001 | Chen et al., 2002 | Yamamoto et al., 2004 | Zheng et al., 2006 | Xu et al., 2006
>SARE;Salicylic acid signalling-related;SA-responsive element. Found in CaMV 35S promoter. Identical to as-1. ASF-1  (Activation Sequence Factor-1) binding site;CTGACGTAAGGGATGACGCAC;Cauliflower mosaic virus;PLACE;Qin et al., 1994
>SRE;Sugar response-related;Sugar-Repressive Element. Found enriched in Arabidopsis down-regulated genes in outgrowing axillary buds after main stem decapitation. These genes were also reduced after sugars application;TTATCC;A. thaliana;PLACE;Tatematsu et al., 2005
>Sugar reppression E;Sugar response-related;Sugar reppression Element. Found in rice RAmy3D gene promoter which expression ins reppressed by sugar in rice callus-forming embryos;TACGTA;O.sativa;-;Toyofuku et al., 1998
>Sucrose box;Sugar response-related;Found in sugar-responsive grape berry hexose transporter (Vvht1) gene for ripening expression;NNAATCA;V. vinifera;-;Fillion et al., 1999
>Suc RE;Sugar response-related;SURE, SUcrose Responsive Element. Conserved among genes regulated by sucrose and found in the patatin (a major tuber protein) gene promoter of potato;AATAGAAAA;S.tuberosum;PLACE;Grierson et al., 1994
>Suc RE ii;Sugar response-related;SURE2, SUcrose Responsive Element 2. Conserved among genes regulated by sucrose and found in the patatin (a major tuber protein) gene promoter of potato;AATACTAAT;S.tuberosum;PLACE;Grierson et al., 1994
>Sugar RE;Sugar response-related;Sugar-responsive element (SURE-a) found in barley iso1 (isoamylase1) promoter. Highly similar to SURE of potato class-1 putative promoter. Starch synthesis- and carbohydrate anabolism-related SUSIBA2 (WRKY) binding site;AAAACTAAGAAAGACCGATGGAAAA;H.vulgare L.;PLACE;Sun et al., 2003
>UPRE;Unfolded protein response-related;ERSEII-like sequence. Found in the plant UPRE (Unfolded Protein Response Element) in A.thaliana. Either of ERSEII or XBP1 binding sites is essential and sufficient for the UPR. Motif II in the conserved UPR, found in SAR1B, HSP-90, SBR-like, Ca-ATPase 4, CNX1, and PDI gene promoters;CCNNNNNNNNNNNNCCACG;A. thaliana;PLACE;Oh et al., 2003 | Martinez and Chrispeels, 2003
>UPRE ii;Unfolded protein response-related;ERSEII-like sequence. Found in the plant UPRE (Unfolded Protein Response Element) in A.thaliana. Either of ERSEII or XBP1 binding sites is essential and sufficient for the UPR. Motif II in the conserved UPR, found in SAR1B, HSP-90, SBR-like, Ca-ATPase 4, CNX1, and PDI gene promoters;ATTGGTCCACG;A. thaliana;PLACE;Oh et al., 2003 | Martinez and Chrispeels, 2003
>UPRE iii;Unfolded protein response-related;ERSEII-like sequence. Found in the plant UPRE (Unfolded Protein Response Element) in A.thaliana. Either of ERSEII or XBP1 binding sites is essential and sufficient for the UPR. Motif II in the conserved UPR, found in SAR1B, HSP-90, SBR-like, Ca-ATPase 4, CNX1, and PDI gene promoters;CCACGTCATG;A. thaliana;PLACE;Oh et al., 2003 | Martinez and Chrispeels, 2003
>ARE;Oxidative signalling-related;Antioxidant-Response Element. EpRE (Electrophile-Responsive Element). Found in mouse MT-I, GST, and NADPH-QR promoters. AP-1  TF family  (yeast YAP-1, Fos, Jun) binding site. Apart from AP-1 and ARE no homologs of other major animal or microbial redox-sensitive elements and factors have been reported in plants. YAP-deleted strains are sensitive to superoxide, H2O2, and oxidant-originating compounds. Found also in maize germination-induced CAT1-3 gene promoters and AtHSP90-1 gene promoter for arsenite induction;TGASTCAG;M.musculus | D.melanogaster | A. thaliana | Z. mays;PLACE;Rushmore et al., 1991 | Dalton et al., 1994 | Pastori and Foyer, 2002
>OsROS-bZIP bs i;Oxidative signalling-related;TGA-type bZIP, cold- and H2O2-inducible (but not ABA-) ROS-bZIP, and OBF (Ocs element Binding Factor, bZIP) binding site. Found in both pathogen and plant promoters specially in GST6 and OCS octopine synthase. Part of the second highly conserved group of motifs in cold- or H2O2-responsive promoters of rice japonica chilling tolerant cultivar (potentially CBF-independent regulon);GATGA;A. thaliana | O.sativa;-;Cheng et al., 2007
>OsROS-bZIP bs ii;Oxidative signalling-related;TGA-type bZIP, cold- and H2O2-inducible (but not ABA-) ROS-bZIP, and OBF (Ocs element Binding Factor, bZIP) binding site. Found in both pathogen and plant promoters specially in GST6 and OCS octopine synthase. Part of the second highly conserved group of motifs in cold- or H2O2-responsive promoters of rice japonica chilling tolerant cultivar (potentially CBF-independent regulon). Signature sequence of W-box in WRKY-target genes;TTGATC;A. thaliana | O.sativa;-;Cheng et al., 2007
>GCC-box;Oxidative signalling-related;GCC-box / ROSE7 (ROS-responsive cis-acting elements). Found in ROS-upregulated gene promoters. Functions in ABA, ethylene and JA. ERF6 interacts with MPK6 and the latter phosphorylates ERF6 affecting its binding and causing transcriptomic changes in response to ROS. ERF/EREBPs (AtERF1, 2, 5, 7, N.tabaccum ERF2-4, L.esculentum Pti4-6 activators and 3 and 4 reppressors) and certain AP2s (AtEBP/RAP2.3, RAP2.6) binding site;GCCGCC;A. thaliana;-;Wang et al., 2013
>as1/ocs element;Oxidative signalling-related;OsROS-bZIP bs iii or JARE (JA-Responsive Element) motif. TGA-type bZIP, cold- and H2O2-inducible (but not ABA-) ROS-bZIP, and OBF (Ocs element Binding Factor, bZIP) binding site. Found in both pathogen and plant promoters, especially in: SA-, auxin- or H2O2-inducible GST6, Agrobacterium OCS (octopine synthase), A.thaliana PDF1.2 and MeJA- and wound-inducible LOX1, and H.vulgare LOX (lipoxygenase). GST6 promoter also contains OBP1, 4, 5 (OBF-binding protein) binding site and OBP1 stimulates OBFs binding (Zhang et al., 1995). Part of the second highly conserved group of motifs in cold- or H2O2-responsive promoters of rice japonica chilling tolerant cultivar (potentially CBF-independent regulon);TGACG;A. thaliana | A. tumefaciens | H.vulgare L. | O.sativa;-;Bouchez et al., 1989 | Chen et al., 1996 | Rouster et al., 1997 | Chen and Singh, 1999 | Cheng et al., 2007
>ARE ii;Oxidative signalling-related;Antioxidant-Response Element. EpRE (Electrophile-Responsive Element). Found in mouse MT-I, GST, and NADPH-QR promoters. AP-1  TF family  (yeast YAP-1, Fos, Jun) binding site. Apart from AP-1 and ARE no homologs of other major animal or microbial redox-sensitive elements and factors have been reported in plants. YAP-deleted strains are sensitive to superoxide, H2O2, and oxidant-originating compounds. Found also in maize germination-induced CAT1-3 gene promoters and AtHSP90-1 gene promoter for arsenite induction;GTGACNNNGC;M.musculus | D.melanogaster;PLACE;Rushmore et al., 1991 | Dalton et al., 1994 | Pastori and Foyer, 2002
>ZAP1 bs;Miscellaneous group;A. thaliana root and flower high expressed ZAP1 (Zn-dependent Activator protein) binding site;TTGACCGAG;A. thaliana;footprintDB;Pater et al., 1996
>ATBH-1/HAT5 bs;Miscellaneous group;Leaf development-related ATHB-1 / HAT5 (HomeoBox domain, HDZip) binding site;CAATTATTG;A. thaliana;footprintDB;Sessa et al., 1993, 1997 | Aoyama et al., 1995
>ATBH5 bs;Miscellaneous group;ATHB5 (Homeobox domain, Homeobox associated leucine zipper HDZip) binding site. A majority of other HDZip members interact with similar DNA sequences but prefer central A/T over G/C residues;BSYSCAATTATTG;A. thaliana;footprintDB;Johannesson et al., 2001
>ATBH9 bs;Miscellaneous group;ATHB9 (Homeobox domain, START domain, MEKHLA domain) binding site;AAHYGTAATGATTRCWYBS;A. thaliana;footprintDB;Sessa et al., 1993
>Pro/Hypoosm.-RE;Miscellaneous group;Proline- and / or Hypoosmolarity-Responsive Element. Found in A.thaliana ProDH gene. AtbZIP11/ATB2, AtbZIP44, AtbZIP2/GBF5 and AtbZIP53 binding site;ACTCAT;A. thaliana;PLACE  | AGRIS;Satoh et al., 2004
>AtMYB84 bs;Miscellaneous group;AtMYB84 binding site;GGGGGGTAGGTGS;A. thaliana;footprintDB;Romero et al., 1998
>AtMYB77 bs;Miscellaneous group;AtMYB77 binding site;MADYGACRGTTRS;A. thaliana;footprintDB;Romero et al., 1998
>HAHB4 bs;Miscellaneous group;Sunflower HAHB4 (HomeoBox domain, HDZip) binding site;TAATRATTG;H. annus;footprintDB;Palena et al., 1999
>ARR2 bs;Miscellaneous group;A. thaliana type B ARR2 binding site. ARR2 is a pollen-specific TF involved in the expression of nuclear genes for components of mitochondrial complex I;TYTWKGATTGTS;A. thaliana;footprintDB;Sakai et al., 2000 | Lohrmann et al., 2001
>ARR10 bs;Miscellaneous group;Type B ARR10 binding motif. B motif has a NLS and binds to this motif in DNA. Homologous motifs occur in GARP TF family;GSKWAGATHYKC;A. thaliana;footprintDB;Hosoda et al., 2002
>PCF5 bs;Miscellaneous group;TCP TF binding site. Assessed specifically with PCF proteins as maize TB1;GTGGYCCCSY;O.sativa;footprintDB;Kosugi et al., 2002
>OsCBT bs;Miscellaneous group;CaM-binding and elicitor-stimulated rice OsCBT binding site. Similar to AtSRs / AtCAMTAs. OsCBT could fulfill a negative role in plant pathogen defense;TMCGYGTKKKKTKCG;O.sativa;footprintDB;Koo et al., 2009
>PCF2 bs;Miscellaneous group;TCP TF binding site. Assessed specifically with PCF proteins as maize TB1;TGGGSCCCAC;O.sativa;footprintDB;Kosugi et al., 2002
>CAD1-A W-box;Miscellaneous group;Found in cotton sesquiterpene biosynthesis-related CAD1-A (delta-cadinene synthase-A) gene promoter. GaWRKY1  binding site;AGTCAAAATTGACC;G.arboreum;PLACE;Xu et al., 2004
>RSRE;Miscellaneous group;Rapid Stress Responsive-Element. Mutational analysis revealed that it is sufficient to confer a rapid response to stress signals. Found enriched in mechanical wounding-responsive promoters (as a common stimulus to a broad range of stresses). Yeast GSR (General Stress Response) components are evolutionarily conserved in all organisms. RWR (Rapid Wound Responsive) transcripts included A. thaliana ZAT12, CBF2, STZ, ACS6, ERD15, BAP1, MPK3, TGA3, CAF1, SYD, and others. Coupling element 3, ABRE-related and found enriched in soybean promoters of cold-inducible genes (Maruyama et al., 2012). SR/CAMTA binding site (Doherty et al., 2009);CGCGTT;A. thaliana;-;Walley et al., 2007
>Type IIG Myb bs;Miscellaneous group;Type IIG Myb recognition sequence;GKTWGGTR;A. thaliana;-;Romero et al., 1998
>Type I Myb bs;Miscellaneous group;Type I Myb recognition sequence;CNGTTR;A. thaliana;-;Romero et al., 1998
>Type II Myb bs;Miscellaneous group;Type IIG Myb recognition sequence;GKTWGTTR;A. thaliana;-;Romero et al., 1998
>AtMyb1 bs;Miscellaneous group;AtMyb1 binding site;MTCCWACC;A. thaliana;-;Martin and Paz-Ares, 1997
>AtMyb2 bs;Miscellaneous group;AtMyb2 binding site;TAACSGTT;A. thaliana;-;Martin and Paz-Ares, 1997
>AtMyb3 bs;Miscellaneous group;AtMyb3 binding site;TAACTAAC;A. thaliana;-;Martin and Paz-Ares, 1997
>Plant MYB bs;Miscellaneous group;Plant MYB binding site. Consensus sequence P-box-related found in promoters of phenylpropanoid biosynthetic genes such as PAL, CHS, CHI, DFR, CL, and Bz1. Binding activities from tobacco and A. majus flowers were assessed similar to an A. majus Myb305 TF;MACCWAMC;A. majus | P. vulgaris | P. hybrida | N. tabaccum | A. thaliana;PLACE;Sablowski et al., 1994
>Sulfur RE;Miscellaneous group;Core of SUlphur-Responsive Element (SURE). Found in A. thaliana sulfate transporter SULTR1. Contains an auxin response factor (ARF) binding sequence;GAGACA;A. thaliana;PLACE;Maruyama-Nakashita et al., 2005
>MRE;Miscellaneous group;Metal-responsive element. Found in human and mouse metallothionein genes and in and the tomato type II metallothionein-like gene;TGCRCNC;M.musculus | H. sapiens | L. esculentum;PLACE;Culotta and Hamer, 1989
>PHO-like element;Miscellaneous group; Identified in A. thaliana, rice, barley, and wheat Pi transporter promoters as TaPT2 for root Pi-deficiency expression. TaPT2 promoter can carry out the same regulation in A. thaliana;GDHGTGG;A. thaliana | H. vulgare L., O. sativa | T.aestivum;-;Mukatira et al., 2001 | Tittarelli et al., 2007
>PHR1 bs;Miscellaneous group;MYB-CC TF subfamily PHR1 (PHosphate starvation  Response 1) binding site. PHR1 is involved in Pi starvation signaling and is related to PHOSPHORUS STARVATION RESPONSE 1(PSR1) gene from C. reinhardtii. Found in Pi starvation-responsive structural genes;GNATATNC;A. thaliana;PLACE;Rubio et al., 2001
>GBF1 bs / G-box;Miscellaneous group;G-box factors (GBFs, bZIP) binding site;CCACGTGG;A. thaliana;footprintDB;Schindler et al., 1992 | Menkens et al., 1995
>GBF1 bs;Miscellaneous group;GBF1 binding site;TGACGTGT;A. thaliana;footprintDB;Schindler et al., 1992
>TGA1a bs;Miscellaneous group;Tobacco TGA1a bZIP binding site;SHSACGTSWS;N. tabaccum;footprintDB;Izawa et al., 1993
>Hex motif;Miscellaneous group;GBF1 and TGA1 bZIP binding site. Found in wheat histone3 promoter. unlike GBFs TGA1 seems not to form heterodimers and also TGA1 and members of the GBF family differ in their DNA binding properties;TGACGTGG;A. thaliana | T.aestivum;footprintDB;Schindler et al., 1992
>STGA1/ST1-2 bs;Miscellaneus group;G.max bZIP factors (STGA1 and STF1-2) binding site. STF1 heterodimerizes with GBF proteins;TGACGTGR;G.max | A. thaliana;PLACE;Cheong et al., 1998
>CDC5 bs;Miscellaneus group;Putative MYB domain-containing CDC5 TF binding site. Found enriched in MIR166a, MIR167a, MIR171a, and MIR172b promoter fragments. Reduced levels of pri-miRNAs and less accumulation of miRNAs were found in cdc5-1 mutant. CDC5 interacts with Pol II and its lack in cdc5-1 reduces MIR promoter activity and their Pol II occupancy. CDC5 may also have a role in promoting miRNA maturation;CTCAGCG;A. thaliana;footprintDB;Hirayama and Shinozaki, 1996 | Zhang et al., 2013
